View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_25 (Length: 370)
Name: NF7966_low_25
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 40575808 - 40575629
Alignment:
| Q |
19 |
aaatctcgtcttccaaatttttgtttacttgtttccgtttaattgtcnnnnnnnataaaaactttttgaaggacttaacttatcaatagaatggtattgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40575808 |
aaatctcgtcttccaaatttttgtttaattgtttccgtttaattgtctttttttataaaaactttttgaaggacttaacttatcaatagaatggtattct |
40575709 |
T |
 |
| Q |
119 |
ttgaatgcatttaattgtttaaatcttatctcaagattaaaatgatatttgatgtattgaataattgacaacagtttgaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40575708 |
ttgaatgcatttaattgtttaaatcttatctcaagactaaaatgatatttgatgtattgaataattgacaacagtttgaa |
40575629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University