View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_29 (Length: 335)
Name: NF7966_low_29
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 49070779 - 49070566
Alignment:
| Q |
22 |
aagagtagtaggcatgagatagaaacaggtgaaataagcagcagaaaaagtgaaacgaggtggaggcatattttacggttccattgagggacatagaggc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49070779 |
aagagtagtaggcatgagatagaaacaggtgaaataagcagcagaaaaagtgaaacgaggtggaggcatattttacggttccattgagggacatagaggc |
49070680 |
T |
|
| Q |
122 |
gtcacgttctctttgagagagataagaaacaaaggcatagacacggctt-ttttccccctgattcaaatcttgcaacaccctcacactagccacatttcc |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49070679 |
gtcacgttctctttgagagagataagagacaaaggcatagacacggcttttttttcccctgattcaaatcttgcaacaccctcacactagccacatttcc |
49070580 |
T |
|
| Q |
221 |
aaatttaccaaaga |
234 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49070579 |
aaatttaccaaaga |
49070566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 49070569 - 49070514
Alignment:
| Q |
269 |
aagattcccaacatacaccttatgaggaccttcatagtatattgttcttcttctca |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49070569 |
aagattcccaacatacaccttatgaggaccttcatagtatattgttcttcttctca |
49070514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University