View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_35 (Length: 307)
Name: NF7966_low_35
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 95 - 185
Target Start/End: Complemental strand, 8884527 - 8884437
Alignment:
| Q |
95 |
catatccttatctctaacataacccatcactcgctggtgacacatgctaccaattcatatttatccttgattcccattttataaatcaaat |
185 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884527 |
catatccttgtctctaacgtaacccatccctcgctggtgacacattctaccaattcatatttatccttgattcccattttataaatcaaat |
8884437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 23 - 99
Target Start/End: Complemental strand, 8884633 - 8884557
Alignment:
| Q |
23 |
atcttatgcattctttgggaaataactaactagtacttaacctatttaattaggttctacgcatatcgttctcatat |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884633 |
atctgatgcattctttgggaaataactaactagtacttaacttatttaattaggttctacgcatatcgttctcatat |
8884557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University