View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7966_low_39 (Length: 282)

Name: NF7966_low_39
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7966_low_39
NF7966_low_39
[»] chr1 (3 HSPs)
chr1 (110-195)||(560814-560899)
chr1 (218-269)||(560891-560942)
chr1 (26-77)||(560762-560813)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 110 - 195
Target Start/End: Original strand, 560814 - 560899
Alignment:
110 aaaaccaattataccgaaaaacatctaaacatgtcaaaagcagttatatatccctagaaccaattttatattctgtaaaagtagaa 195  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||    
560814 aaaaccaattctaccgaaaaatatctaaacatgtcaaaagcagttatatatccctagaaccaattttatatcctgtaatagtagaa 560899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 560891 - 560942
Alignment:
218 atagcagaaaccataatgataattggttgattttgttttaggggaagataat 269  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||    
560891 atagtagaaaccataatgataattggttgattttgttttaggggaagataat 560942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 26 - 77
Target Start/End: Original strand, 560762 - 560813
Alignment:
26 cagtaaaagttaattgaatcataaatttgagtgtcaaaatcacgatcaattt 77  Q
    ||||||||||||||||||| |||||||||||||||||||||||| |||||||    
560762 cagtaaaagttaattgaataataaatttgagtgtcaaaatcacgttcaattt 560813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University