View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_39 (Length: 282)
Name: NF7966_low_39
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 110 - 195
Target Start/End: Original strand, 560814 - 560899
Alignment:
| Q |
110 |
aaaaccaattataccgaaaaacatctaaacatgtcaaaagcagttatatatccctagaaccaattttatattctgtaaaagtagaa |
195 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
560814 |
aaaaccaattctaccgaaaaatatctaaacatgtcaaaagcagttatatatccctagaaccaattttatatcctgtaatagtagaa |
560899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 560891 - 560942
Alignment:
| Q |
218 |
atagcagaaaccataatgataattggttgattttgttttaggggaagataat |
269 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
560891 |
atagtagaaaccataatgataattggttgattttgttttaggggaagataat |
560942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 26 - 77
Target Start/End: Original strand, 560762 - 560813
Alignment:
| Q |
26 |
cagtaaaagttaattgaatcataaatttgagtgtcaaaatcacgatcaattt |
77 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
560762 |
cagtaaaagttaattgaataataaatttgagtgtcaaaatcacgttcaattt |
560813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University