View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_5 (Length: 591)
Name: NF7966_low_5
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 3e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 12830545 - 12830410
Alignment:
| Q |
10 |
attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaacataatcattttcggttttagtgatattaaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12830545 |
attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaaaataatcattttcggttttagtgatattaaat |
12830446 |
T |
 |
| Q |
110 |
ttgtagtgttcatattagtgatacttgcctcaaggt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12830445 |
ttgtagtgttcatattagtgatacttgcctcaaggt |
12830410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University