View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_56 (Length: 236)
Name: NF7966_low_56
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 5352490 - 5352271
Alignment:
| Q |
14 |
tttttatcattctgattcttactcatttcttctgttattgcaaaatcacgttcttttgattctttcaagttttgttttgtggttggtacaacatacacga |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5352490 |
tttttatcattctgattcttattcatttcttctgttattgcaaaatcacgttcttttgattctttgaagttttgttttgtggttggtacaacatacacga |
5352391 |
T |
 |
| Q |
114 |
agcacttggtacactcacacattgtacaccaaccacttgtgctagacatgtatcattttgnnnnnnnacacacaagttttatttattatcattctcttca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5352390 |
agcacttggtacactcacacattgtacaccaaccacttgtgctagacatgtatcattttgtttttttacacacaagttttatttattatcattctcttca |
5352291 |
T |
 |
| Q |
214 |
ta-tttttacaaaaggaata |
232 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
5352290 |
tattttttacaaaaggaata |
5352271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University