View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_60 (Length: 223)
Name: NF7966_low_60
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 206
Target Start/End: Original strand, 43231752 - 43231946
Alignment:
| Q |
12 |
ataatacttggcgagactttgatttttattttactttatgaaaaataaattgtattttatgactcatcaaaataatagcaagaaatataaattttagaat |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231752 |
ataatacttggtgagactttgatttttattttactttatgaaaaataaattgtattttatgactcatcaaaataatagcaagaaatataaattttagaat |
43231851 |
T |
 |
| Q |
112 |
tcactttagtgagccacgagtccttgaaacaatcctcattcattgcaactcattgaaaaaacaacattgatatttcgagataattttgacacttt |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231852 |
tcactttagtgatccacgagtccttgaaacaatcctcattcattgcaactcattgaaaaaacaacattgatatttcgagataattttgacacttt |
43231946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University