View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_62 (Length: 213)
Name: NF7966_low_62
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_62 |
 |  |
|
| [»] scaffold0019 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 16 - 148
Target Start/End: Complemental strand, 37959531 - 37959399
Alignment:
| Q |
16 |
tttggtgttgtgcggagaccgctggggcagagctatgagactgaaatctggtggctttaattagatttcagcgtcataacttttgctatttgcttggttt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959531 |
tttggtgttgtccggagaccgctggggcagagctatgagactgaaatctggtggctttaattagatttcagcgtcataacttttgctatttgcttggttt |
37959432 |
T |
 |
| Q |
116 |
tagctcttggttggggttccactgttttagctt |
148 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
37959431 |
tagcccttggttggggttccactgttttagctt |
37959399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 14848638 - 14848597
Alignment:
| Q |
148 |
tctaagcgtcttgctagagtttcggtttcaataatatttgcc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14848638 |
tctaagcgtcttgctagagtttcggtttcaataatatttgcc |
14848597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 189
Target Start/End: Complemental strand, 19109506 - 19109470
Alignment:
| Q |
153 |
gcgtcttgctagagtttcggtttcaataatatttgcc |
189 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19109506 |
gcgtcttgcgagagtttcggtttcaataatatttgcc |
19109470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 189
Target Start/End: Complemental strand, 40875696 - 40875660
Alignment:
| Q |
153 |
gcgtcttgctagagtttcggtttcaataatatttgcc |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40875696 |
gcgtcttgctagagtatcggtttcaataatatttgcc |
40875660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 186
Target Start/End: Complemental strand, 11238934 - 11238901
Alignment:
| Q |
153 |
gcgtcttgctagagtttcggtttcaataatattt |
186 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
11238934 |
gcgtcttgctagagtttcggattcaataatattt |
11238901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 22697407 - 22697365
Alignment:
| Q |
148 |
tctaagcgtcttgctagagt-ttcggtttcaataatatttgcc |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22697407 |
tctaagcgtcttgctagagggttcggtttcaataatatttgcc |
22697365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 98
Target Start/End: Complemental strand, 150237 - 150184
Alignment:
| Q |
45 |
gagctatgagactgaaatctggtggctttaattagatttcagcgtcataacttt |
98 |
Q |
| |
|
|||||||| || |||||| ||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
150237 |
gagctatgggaatgaaatatggtgcctttaactagatttcaacgtcataacttt |
150184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 98
Target Start/End: Complemental strand, 179077 - 179024
Alignment:
| Q |
45 |
gagctatgagactgaaatctggtggctttaattagatttcagcgtcataacttt |
98 |
Q |
| |
|
|||||||| || |||||| ||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
179077 |
gagctatgggaatgaaatatggtgcctttaactagatttcaacgtcataacttt |
179024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 32263859 - 32263904
Alignment:
| Q |
55 |
actgaaatctggtggctttaattagatttcagcgtcataacttttg |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||| || ||||||||||||| |
|
|
| T |
32263859 |
actgaaatctggtggcgttaattatattttagtgtcataacttttg |
32263904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 20446897 - 20446938
Alignment:
| Q |
149 |
ctaagcgtcttgcta-gagtttcggtttcaataatatttgcc |
189 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
20446897 |
ctaagcgtcttgctaagagtttcggttccaataatatttgcc |
20446938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 20532660 - 20532701
Alignment:
| Q |
149 |
ctaagcgtcttgcta-gagtttcggtttcaataatatttgcc |
189 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
20532660 |
ctaagcgtcttgctaagagtttcggttccaataatatttgcc |
20532701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University