View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7968_low_6 (Length: 311)
Name: NF7968_low_6
Description: NF7968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7968_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 39725765 - 39725501
Alignment:
| Q |
1 |
gagagattcccaccaaacaatgtgttactaacgttggcaggggcagggttactatggatgggatgggcaggtttcaacggtggagatccctactctgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725765 |
gagagattcccaccaaacaatgtgttactaacgttggcaggggcagggttactatggatgggatgggcaggtttcaacggtggagatccctactctgcca |
39725666 |
T |
 |
| Q |
101 |
acattgattcatccatggctgttctcaacacaaacatttgtgctgctacaagcctccttgtatggacatggcttgatgtcatattcttcaaaaaaccatc |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725665 |
acattgattcatcaatggctgttctcaacacaaacatttgtgctgctacaagcctccttgtatggacatggcttgatgtcatattcttcaaaaaaccatc |
39725566 |
T |
 |
| Q |
201 |
agttattggagctgttcaaggcatgattactggtcttgtttgcattactcccggagctggtacgt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725565 |
agttattggagctgttcaaggcatgattactggtcttgtttgcattactcccggagctggtacgt |
39725501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 172 - 248
Target Start/End: Complemental strand, 13348598 - 13348522
Alignment:
| Q |
172 |
cttgatgtcatattcttcaaaaaaccatcagttattggagctgttcaaggcatgattactggtcttgtttgcattac |
248 |
Q |
| |
|
||||||||||| ||||||| ||| || || |||||||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
13348598 |
cttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcattac |
13348522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 5624657 - 5624491
Alignment:
| Q |
1 |
gagagattcccaccaaacaatgtgttactaacgttggcaggggcagggttactatggatgggatgggcaggtttcaacggtggagatccctactctgcca |
100 |
Q |
| |
|
||||||||||||||||||||||| || || | | | ||||| ||||| || |||||||||| ||| |||| ||||| ||||||| || || | || | |
|
|
| T |
5624657 |
gagagattcccaccaaacaatgtattgcttatgctagcaggagcaggattgttatggatgggttggtcagggttcaatggtggagcaccatatgcagcaa |
5624558 |
T |
 |
| Q |
101 |
acattgattcatccatggctgttctcaacacaaacatttgtgctgctacaagcctccttgtatggac |
167 |
Q |
| |
|
||||||| || || || ||||| |||||||| ||||| |||||||| || || || ||||| ||||| |
|
|
| T |
5624557 |
acattgactcttctattgctgtactcaacactaacatatgtgctgcaactagtcttcttgtgtggac |
5624491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 257
Target Start/End: Complemental strand, 5624465 - 5624401
Alignment:
| Q |
193 |
aaaccatcagttattggagctgttcaaggcatgattactggtcttgtttgcattactcccggagc |
257 |
Q |
| |
|
||||| ||||| ||||| |||||||| || ||||| || || ||||||||||||||||| ||||| |
|
|
| T |
5624465 |
aaaccttcagtgattggtgctgttcagggtatgatgacaggacttgtttgcattactccaggagc |
5624401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University