View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7969_high_1 (Length: 210)
Name: NF7969_high_1
Description: NF7969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7969_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 34 - 144
Target Start/End: Complemental strand, 35446021 - 35445905
Alignment:
| Q |
34 |
ggtacaatgaattatcattataaatagagagcttgagtgaattggcagaaaaatcggcagagaaga------gagtgagagnnnnnnngacttcaagact |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
35446021 |
ggtacaatgaattatcattataaatagagagcttgagtgaattggcagaaaaatcggcagagaagagagctcgagtgagagaaaaaaagacttcaagact |
35445922 |
T |
|
| Q |
128 |
tggaaaataggtacacg |
144 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35445921 |
tggaaaataggtacacg |
35445905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 176 - 210
Target Start/End: Complemental strand, 35445873 - 35445839
Alignment:
| Q |
176 |
catcgattcatacttattacacaatttttatgttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35445873 |
catcgattcatacttattacacaatttttatgttt |
35445839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University