View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7970_high_9 (Length: 212)
Name: NF7970_high_9
Description: NF7970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7970_high_9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 43644780 - 43644585
Alignment:
| Q |
17 |
attgtatgttccatgaaaactgaagcatttacttgttacatgcaggtcctggtgcaagtattggagggatgtgtgctacacgttgctctggttcgttagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43644780 |
attgtatgttccatgaaaactgaagcatttacttgttaaatgcaggtcctggtgcaagtattggagggatgtgtgctacacgttgctctggttcgttagc |
43644681 |
T |
|
| Q |
117 |
tgtgaggtggctactttccttttatatgnnnnnnncatctattgctggcaatcactgccacctgctggttaaaatgtttaaactctgcgggtgtca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43644680 |
tgtgaggtggctactttccttttatatgtttttttcatctattgctggcaatcactgccacctgctggttaaaatgtttaaactctgtgggtgtca |
43644585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University