View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_high_19 (Length: 262)
Name: NF7971_high_19
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 2461700 - 2461852
Alignment:
| Q |
1 |
tttgagattttattggctagggcgaacctactaaatttaaattaccgaagtgtggaaataatttccaagtaatgaatgtctgtatacaacttcaacaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||| |||| || ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||| |
|
|
| T |
2461700 |
tttgagattttattggctagggtgaacttagtaaatttgaattaccgaagtgtggaaataatttccaagtaatgaatgtctatatacagcatcaacaaaa |
2461799 |
T |
 |
| Q |
101 |
aggtgttggtgttacaattaatgaccacaaaatctgagagagaataccaagca |
153 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2461800 |
aggtgttggtgttaccattaatgaccacaaaatctgagagagaacaccaagca |
2461852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 178 - 239
Target Start/End: Original strand, 2462659 - 2462720
Alignment:
| Q |
178 |
ctttcaaatctcttctaactcaagggctatgagccactatgattcattacaaattatgattc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2462659 |
ctttcaaatctcttctaactcaagggctatgagccactatgattcattacaaattatgattc |
2462720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 193 - 239
Target Start/End: Original strand, 2485474 - 2485520
Alignment:
| Q |
193 |
taactcaagggctatgagccactatgattcattacaaattatgattc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2485474 |
taactcaagggctatgagccactatgattcattacaaattatgattc |
2485520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University