View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_high_9 (Length: 358)
Name: NF7971_high_9
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 48879548 - 48879889
Alignment:
| Q |
1 |
ttccagctgagcaagagtagtattcatcacatacagttgaaggctgaacaggtgatggaggtgaaggaccaggatttggtgggttctgacccttcttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879548 |
ttccagctgagcaagagtagtattcatcacatacagttgaaggctgaacaggtgatggaggtgaaggaccaggatttggtgggttctgacccttcttgat |
48879647 |
T |
 |
| Q |
101 |
aggataggatgcctccattgcaattccacacttgccagtttcttttgttaacaaatttctctccatcttaatgtagccattttcaccccatgatgaaccc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879648 |
aggatatgatgcctccattgcaattccacacttgccagtttcttttgttaacaaatttctctccatcttaatgtagccattttcaccccatgatgaaccc |
48879747 |
T |
 |
| Q |
201 |
catgagttcctcactaaccagtaatcgatcccgttctctgttccatatccaaccactgcaacaccgtgatcaagttctgttccacaaatgccagtaaaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879748 |
catgagttcctcactaaccagtaatcgatcccgttctctgttccatatccaaccactgcaacaccgtgatcaagttctgttccacaaatgccagtaaaaa |
48879847 |
T |
 |
| Q |
301 |
caccctggatcgacaaaaatcaaaatttgagacagcattcat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879848 |
caccctggatcgacaaaaatcaaaatttgagacagcattcat |
48879889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 84 - 124
Target Start/End: Complemental strand, 24743695 - 24743655
Alignment:
| Q |
84 |
ttctgacccttcttgataggataggatgcctccattgcaat |
124 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
24743695 |
ttctgaccattcttgataggatatgatggctccattgcaat |
24743655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University