View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_low_10 (Length: 416)
Name: NF7971_low_10
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 256 - 404
Target Start/End: Original strand, 40652063 - 40652210
Alignment:
| Q |
256 |
gccggctggtcaccggttccattctccgatcactttcccgaccacttccattcctccaatcccgattaactctccgatcatttttattatttcccctttt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652063 |
gccggctggtcaccggttccattctccgatcactttcccgaccacttccattcctccaatcccgattaactctccgatcatttttattatttcccctttt |
40652162 |
T |
 |
| Q |
356 |
ggtgagttttcatataatcttttgaatttgtttcaatcatgcatgtttt |
404 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652163 |
ggtgag-tttcatataatcttttgaatttgtttcaatcatgcatgtttt |
40652210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 113 - 220
Target Start/End: Original strand, 40651920 - 40652027
Alignment:
| Q |
113 |
ggtgacgtgcagcagtgcgattgtagccattaaaatcggcttcaagttctcctctcctttcgtcccgccttttttcttccaaccatcctcacaatgcaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651920 |
ggtgacgtgcagcagtgcgattgtagccattaaaatcggcttcaagttctcctctcctttcgtcccgccttttttcttccaaccatcctcacaatgcaat |
40652019 |
T |
 |
| Q |
213 |
cttccctc |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
40652020 |
cttccctc |
40652027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University