View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7971_low_23 (Length: 262)

Name: NF7971_low_23
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7971_low_23
NF7971_low_23
[»] chr4 (3 HSPs)
chr4 (1-153)||(2461700-2461852)
chr4 (178-239)||(2462659-2462720)
chr4 (193-239)||(2485474-2485520)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 2461700 - 2461852
Alignment:
1 tttgagattttattggctagggcgaacctactaaatttaaattaccgaagtgtggaaataatttccaagtaatgaatgtctgtatacaacttcaacaaaa 100  Q
    |||||||||||||||||||||| |||| || ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||    
2461700 tttgagattttattggctagggtgaacttagtaaatttgaattaccgaagtgtggaaataatttccaagtaatgaatgtctatatacagcatcaacaaaa 2461799  T
101 aggtgttggtgttacaattaatgaccacaaaatctgagagagaataccaagca 153  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||||||||    
2461800 aggtgttggtgttaccattaatgaccacaaaatctgagagagaacaccaagca 2461852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 178 - 239
Target Start/End: Original strand, 2462659 - 2462720
Alignment:
178 ctttcaaatctcttctaactcaagggctatgagccactatgattcattacaaattatgattc 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2462659 ctttcaaatctcttctaactcaagggctatgagccactatgattcattacaaattatgattc 2462720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 193 - 239
Target Start/End: Original strand, 2485474 - 2485520
Alignment:
193 taactcaagggctatgagccactatgattcattacaaattatgattc 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
2485474 taactcaagggctatgagccactatgattcattacaaattatgattc 2485520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University