View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_low_24 (Length: 262)
Name: NF7971_low_24
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 4624293 - 4624526
Alignment:
| Q |
1 |
caacagacatatccctcgaggtaactgagatacatttaagcgaactctggactaacacagatcgaactaagatgctgacatgttcctgtcccgcaaattc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4624293 |
caacagacttatccctcgaggtaactgagatacatttaagcgaactctggaccaacagagatcgaactaagatgccaacatgttcctgtcccgcaaattc |
4624392 |
T |
 |
| Q |
101 |
ggcaaaattttacttttagttgaatacttacatgtaataataactgtgaaattgttaatgttttgaccacacctcaagatatccctttcaaagaaataaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
4624393 |
ggcaaaattttacttttagttgaatacttacatgtaataataactgtgaaattgttaatgttttggccacacctcaagatatccctttc---------aa |
4624483 |
T |
 |
| Q |
201 |
agaaatgaaccaaaattgattctgacaataaccaaacgccaaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4624484 |
agaaatgaaccaaaattgattctgacaataaccaaacaccaaa |
4624526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University