View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_low_25 (Length: 260)
Name: NF7971_low_25
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 5624273 - 5624372
Alignment:
| Q |
143 |
ttaaatacacgacgatgtattgttgttatgatccactgagattcaatctttatcgctttaaaaaattatttattaaataattgatcataggaacagaact |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5624273 |
ttaaatacacgacgatgaattgttgttatgatccactgagattcaatctttatcgctttaaaaaattatttattaaataattgatcataggaacagaact |
5624372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University