View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_low_32 (Length: 238)
Name: NF7971_low_32
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 48879441 - 48879205
Alignment:
| Q |
1 |
tgactacccggtctgcgatgttgaagctggaacttgccgattggtaattatcttatttcttccttaagtctatttctattacaaataagaaccatcaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48879441 |
tgactacccggtctgcgatgttgaagctggaacttgccgattggtaattatcttatttcttccttaagtctatttctattacagataagaaccatcaaac |
48879342 |
T |
 |
| Q |
101 |
atgtgttgcaa-------------cataggttattgcttctggttgctataaaccacaaataataaccattctcttgttctgtgacttgatgtttcttta |
187 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879341 |
atgtgttgcaattttgtgttgcaacattggttattgcttctggttgctataaaccacaaataataaccattctcttgttctgtgacttgatgtttcttta |
48879242 |
T |
 |
| Q |
188 |
gtttgaaattgatttcatttcctttgtgtgtgcaaca |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48879241 |
gtttgaacttgatttcatttcctttgtgtgtgcaaca |
48879205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University