View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7971_low_36 (Length: 204)
Name: NF7971_low_36
Description: NF7971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7971_low_36 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 54 - 187
Target Start/End: Complemental strand, 340093 - 339960
Alignment:
| Q |
54 |
gtttctacgtcaacccttactctagccattttcctatgaccatgagtaatgaagtcttttaattaattaaacaaccgttcagtaccttatgagtgttatt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
340093 |
gtttctacgtcaacccttactctagccattttcctatgaccatgagtaatgaagtcttttaattaattaaacaaccgtccagtaccttatgagtgttatt |
339994 |
T |
|
| Q |
154 |
ctggactataggcatgtttcaaaaaactaacaga |
187 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
339993 |
ctggattataggcatgtttcaaaaaactaacaga |
339960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University