View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7972_high_10 (Length: 405)
Name: NF7972_high_10
Description: NF7972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7972_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 58 - 390
Target Start/End: Complemental strand, 5579514 - 5579182
Alignment:
| Q |
58 |
tctgagttgttgcaaacatgatg-ttgctttggttttgttatttggatgggtttcttggaatagaagaaaatggcnnnnnnncacttcctaacttgaaat |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5579514 |
tctgagttgttgcaaacatgatgcttgctttggttttgttatttgggtgggtttcttggaatagaagaaaatggctttttt-cacttcctaacttgaaat |
5579416 |
T |
|
| Q |
157 |
aaaatattaaggatggtgtacatcatcaattgtttcaaatactagaagcctcggtacacttcgatcacagaacactgcctgcaagttagtagtattgata |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5579415 |
aaaatattaaggatggtgtacatcatcaattgtttcaaatactagaagcctccgtacacttcgatcacagaacactgcctgcaagttagtagtattgata |
5579316 |
T |
|
| Q |
257 |
ctattagcattgttgatacagttcagtcagagaacactgcaagttagtagtattgatctagattgtaaaataagattgtaaaatagcatctgttggatcc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5579315 |
ctattagcattgttgatacagttcagtcagagaacactgcaagttagtagtattgatctagattgtaaaataagattgtaaaatagcatctgttggatcc |
5579216 |
T |
|
| Q |
357 |
ttttcatcagcattgttgatcccttgaatggagt |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5579215 |
ttttcatcagcattgttgatcccttgaatggagt |
5579182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 357 - 391
Target Start/End: Original strand, 29877479 - 29877513
Alignment:
| Q |
357 |
ttttcatcagcattgttgatcccttgaatggagtg |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
29877479 |
ttttcatcagcattgttgatcccttgaatgcagtg |
29877513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University