View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7972_high_24 (Length: 240)
Name: NF7972_high_24
Description: NF7972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7972_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 42661819 - 42662030
Alignment:
| Q |
16 |
caactatcaagtacataattttgttgctggggattgtaacaccagatttatgtcaagagagttgttcttgcatgcatcgatttgaacaataatatgcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661819 |
caactatcaagtacataattttgttgctggggattgtaacaccagatttatgtcaagagagttgttcttgcatgcatcgatttgaacaataatatgcatt |
42661918 |
T |
|
| Q |
116 |
gtcattgacagaagaggagaaacaatacggttggtaaagctatgagtcacgttaatctacacacatgttacatacttaagggaaatgataataagtatta |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661919 |
gtcattgacaaaagaggagaaacaatacggttggtaaagctatgagtcacgttaatctacacacatgttacatacttaagggaaatgataataagtatta |
42662018 |
T |
|
| Q |
216 |
ttagagtattat |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42662019 |
ttagagtattat |
42662030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University