View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7972_high_26 (Length: 229)
Name: NF7972_high_26
Description: NF7972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7972_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 32 - 128
Target Start/End: Complemental strand, 2434334 - 2434238
Alignment:
| Q |
32 |
aactggccacacattggtttgtacatttatctaacgtatttgtatgaaacaaattgccaaaattgttcgtttaatttaatttcaagtaaggatttag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2434334 |
aactggccacacattggtttgtacatttatctaacgtatttgtatgaaacaaattgccaaaattgttcgtttaatttaatttcaagtaacgatttag |
2434238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University