View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7972_high_27 (Length: 210)
Name: NF7972_high_27
Description: NF7972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7972_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 4166060 - 4165877
Alignment:
| Q |
15 |
atgaagtgatcgggagttaggaactggtagattcagatcataattctactctgttcttcacacaaggtaaaaaggatgtagcgttcgctcaccaatttct |
114 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4166060 |
atgaagtgatcgggagttaggaaccgatagattcggatcataattctactctgttcttcacacaaggtaaaaaggatgtagcgttcgctcaccaatttct |
4165961 |
T |
 |
| Q |
115 |
ctatcgcatcatctgaattccttatgggtcaccagtttttggtcattcaacacatgcaaatgagtttgaggtcgatattgatga |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4165960 |
ctatcgcatcatctgaattccttatgggtcaccggtttttgatcattcaacacatgcaaatgagtttgaggtcgatatggatga |
4165877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University