View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7974_low_2 (Length: 304)
Name: NF7974_low_2
Description: NF7974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7974_low_2 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 23 - 288
Target Start/End: Complemental strand, 44944278 - 44944003
Alignment:
| Q |
23 |
atcatgattaatggcgctattattcataggtttctagtcattttatctcttatggattttggtttcttctgcttcttaggtgt----------catagac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44944278 |
atcatgattaatggcgctattattcataggtttctagtcattttatctcttatggattttggtttcttctgcttcttaggtgtttggagttgtcatagac |
44944179 |
T |
|
| Q |
113 |
agtcatatggatgacttaaaataatgatcattttgtctacattgtgcatattgacttgtcatcgtgactattttgttttttcagtgatcaaaattttaga |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44944178 |
agtcatatggatgccttaaaataatgatcattttgtctacattgtgcatattgacttgtcatcgtgcctattttgttttttcagtgatcaaaattttaga |
44944079 |
T |
|
| Q |
213 |
tggataggatttagtgttctctagtatgatccacttaacattttaatttataatttcatcttcaggaaagtattat |
288 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44944078 |
tggataggatttaatgttctctagtatgatccatttaacattttaatttataatttcatcttcaggaaagtattat |
44944003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 122 - 285
Target Start/End: Complemental strand, 44950086 - 44949923
Alignment:
| Q |
122 |
gatgacttaaaataatgatcattttgtctacattgtgcatattgacttgtcatcgtgactattttgttttttcagtgatcaaaattttagatggatag-g |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||||| ||||||| || |||||||||||||||||||| | |
|
|
| T |
44950086 |
gatgtcttaaaataatgatcattttgtctacattgt-cataatgacttgtcatagtgcctatttcattttttccatgttcaaaattttagatggatagtg |
44949988 |
T |
|
| Q |
221 |
atttagtgttctctagtatgatccacttaacattttaatttataatttcatcttcaggaaagtat |
285 |
Q |
| |
|
| | |||||||| |||||| ||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
44949987 |
ttcaaaggttctctattatgattgacttaacgttttaatttataatttcatcttcgggaaagtat |
44949923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 128 - 281
Target Start/End: Complemental strand, 6470926 - 6470769
Alignment:
| Q |
128 |
ttaaaataat-gatcattttgtctacattgtgcatattgacttgtcatcgtgactattttgttttttcagtgat-caaaattttagatggataggattta |
225 |
Q |
| |
|
|||||||||| ||||||||||| ||||| |||||||||||||||||| ||| ||||||||||||||| || | |||||||| ||| ||||||| || | |
|
|
| T |
6470926 |
ttaaaataattgatcattttgtgtacataatgcatattgacttgtcatagtgcctattttgttttttccatgttccaaaatttgagacggatagggttga |
6470827 |
T |
|
| Q |
226 |
gtg-ttctctagta-tgatccacttaacattttaatttataatttcatcttcaggaaa |
281 |
Q |
| |
|
| |||| || || |||| |||| | ||||||||||||||| ||||| ||||||||| |
|
|
| T |
6470826 |
aagattctttattattgattcactcaccattttaatttataacttcattttcaggaaa |
6470769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 288
Target Start/End: Original strand, 418925 - 418964
Alignment:
| Q |
249 |
aacattttaatttataatttcatcttcaggaaagtattat |
288 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
418925 |
aacattttaatttataatttcattttcaggaaaatattat |
418964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University