View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7975_low_11 (Length: 318)
Name: NF7975_low_11
Description: NF7975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7975_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 22 - 303
Target Start/End: Original strand, 49627869 - 49628147
Alignment:
| Q |
22 |
ttttaattcaaaaccttaaaatataaatttatggatctctcatctatgggtgttccacattcacttttttatccaatgtgagatatattattactcacgt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
49627869 |
ttttaattcaaaaccttaaaatataaatttatggatctctcatctataggtgttccacattcacttttttatccaatgtgagatatatta---cttacgc |
49627965 |
T |
 |
| Q |
122 |
ttgatgtaccaacaatctccacctcaaatgtgagttcatctattatgtaatatatcccccttaaacgaagttttttcatcaacttataccgccgttaaca |
221 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49627966 |
ttgatataccaacaatctccgcctcaagtgtgagttcatctattatgtaatatatctcccttaaacgaagttttttcatcaacttataccgccgttaaca |
49628065 |
T |
 |
| Q |
222 |
gccaccacatcaaccggactcgccatcagaaaatattggtcaggaagactttcgacacaagtagctggtcaaacccttcatc |
303 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49628066 |
gccaccacatcaaccggactcaccgtcagaaaatcttggtcaagaagactttcgacacaagtagctggtcaaacccttcatc |
49628147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University