View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7976_high_7 (Length: 358)
Name: NF7976_high_7
Description: NF7976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7976_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 13 - 326
Target Start/End: Original strand, 47493757 - 47494067
Alignment:
| Q |
13 |
tcaacatcatcctgacgaactcttgataatcaacgagaccgtcaccatccagatcagccgttttgatcatctgttccagttcttcgtctgtcaccttttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47493757 |
tcaacatcatcctgacgaactcttgataatcaacgaggccgtcaccatccagatcagccgttttgatcatctgctccagttcttcgtctgtcaccttttc |
47493856 |
T |
 |
| Q |
113 |
tccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttcaatattacggtacgacaaaacaaattatatatgttgaatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47493857 |
tccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttc---attacggtacaacaaaacaaattatatatgttgaatt |
47493953 |
T |
 |
| Q |
213 |
aattatacctcactgggtgatatgtaaccatctttatctttgtcgaacaccctgaaagcttccttaaattcctcttctgcttcactttcctttttcgtac |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47493954 |
aattatacctcactgggtgatatgtaaccatctttatctttgtcgaacaccctgaaagcttccttaaattcctcttccgcttcactttcctttttcgtac |
47494053 |
T |
 |
| Q |
313 |
ataaaaattcacaa |
326 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
47494054 |
atacaaattcacaa |
47494067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University