View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7977_low_1 (Length: 338)
Name: NF7977_low_1
Description: NF7977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7977_low_1 |
 | |
|
| [»] scaffold0408 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0408 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: scaffold0408
Description:
Target: scaffold0408; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 37 - 310
Target Start/End: Complemental strand, 9604 - 9331
Alignment:
| Q |
37 |
tttgagaacaaacaaaagagaggggatgacacgtggtgattttcggttggctggtcaaagtttacacagattctacttttgatggagggctgggattgtg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| || |||||||||| |
|
|
| T |
9604 |
tttgagaacaaacaaaagagaggggatgacacatggtgatttccggttggctagtcaaagtttatacagattctacttttgatggacggttgggattgtg |
9505 |
T |
|
| Q |
137 |
ccaaaattactagatgcgcatccaatggtggatattggattacatgggtacccagagaaagaaaatcaaacagactctttagggaaaacaattcaaactg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9504 |
ccaaaattactagatgcgcatccaatggtggatattggattacatgggtacctagagaaagaaaatcaaacagactctttagggaaaagaattcaaactg |
9405 |
T |
|
| Q |
237 |
tctggaatacatacgataatatcccagcgacgacaatggcgattggaatccggaggttctggaggcggcggtga |
310 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9404 |
tctggaatatgtacgataatatcccagcgacgacaatggcgattggaatccgatggttctggaggcggcggtga |
9331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 37 - 310
Target Start/End: Complemental strand, 14099262 - 14098989
Alignment:
| Q |
37 |
tttgagaacaaacaaaagagaggggatgacacgtggtgattttcggttggctggtcaaagtttacacagattctacttttgatggagggctgggattgtg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| || |||||||||| |
|
|
| T |
14099262 |
tttgagaacaaacaaaagagaggggatgacacatggtgatttccggttggctagtcaaagtttatacagattctacttttgatggacggttgggattgtg |
14099163 |
T |
|
| Q |
137 |
ccaaaattactagatgcgcatccaatggtggatattggattacatgggtacccagagaaagaaaatcaaacagactctttagggaaaacaattcaaactg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14099162 |
ccaaaattactagatgcgcatccaatggtggatattggattacatgggtacctagagaaagaaaatcaaacagactctttagggaaaagaattcaaactg |
14099063 |
T |
|
| Q |
237 |
tctggaatacatacgataatatcccagcgacgacaatggcgattggaatccggaggttctggaggcggcggtga |
310 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14099062 |
tctggaatatgtacgataatatcccagcgacgacaatggcgattggaatccgatggttctggaggcggcggtga |
14098989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University