View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7979_high_5 (Length: 223)
Name: NF7979_high_5
Description: NF7979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7979_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 742339 - 742149
Alignment:
| Q |
17 |
actttatatcttagaggatgggagtttaactgatggacaaggcagaactgtggattttacgaacacggtcgttatcatgacctcgaaccttggcgctgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742339 |
actttatatcttagaggatgggagtttaactgatggacaaggcagaactgtggattttacgaacacggtcgttatcatgacctcgaaccttggcgctgat |
742240 |
T |
|
| Q |
117 |
catctccaaagtggactttcaggaaaatgtaccatgcaagttgctcacgatcgagtaatgcaggaagtaactgatcatttctggttagaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742239 |
catctccaaagtggactttcaggaaaatgtaccatgcaagttgctcacgatcgagtaatgcaggaagtaactgatcatttctggttagaat |
742149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 42449469 - 42449289
Alignment:
| Q |
17 |
actttatatcttagaggatgggagtttaactgatggacaaggcagaactgtggattttacgaacacggtcgttatcatgacctcgaaccttggcgctgat |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| || ||| |
|
|
| T |
42449469 |
actttatatcttagaggatggaagtttaactgatggacaaggcagaactgtggattttacgaacatggtcattatcatgacctcgaaccttggtgccgat |
42449370 |
T |
|
| Q |
117 |
catctccaaagtggactttcaggaaaatgtaccatgcaagttgctcacgatcgagtaatgcaggaagtaactgatcatttc |
197 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
42449369 |
catctcttaagtggactttcaggaaaatgtaccatccaagtagctcacgatcgagtaatgcaggaagtcagtgagcatttc |
42449289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 34 - 184
Target Start/End: Complemental strand, 740234 - 740079
Alignment:
| Q |
34 |
atgggagtttaactgatggacaaggcagaactgtggattttacga-----acacggtcgttatcatgacctcgaaccttggcgctgatcatctccaaagt |
128 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||||| |||||||| | || ||||||| |||| |
|
|
| T |
740234 |
atgggaggctaactgatggacaaggcagaactgtggattttaggataggaacacagtcattatcatgacctcaaaccttggttccgagcatctcctaagt |
740135 |
T |
|
| Q |
129 |
ggactttcaggaaaatgtaccatgcaagttgctcacgatcgagtaatgcaggaagt |
184 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
740134 |
ggactttcaggaaaatgtaccatggaagttgctcgcgataaagtaatgcaggaagt |
740079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 42 - 186
Target Start/End: Original strand, 10046657 - 10046801
Alignment:
| Q |
42 |
ttaactgatggacaaggcagaactgtggattttacgaacacggtcgttatcatgacctcgaaccttggcgctgatcatctccaaagtggactttcaggaa |
141 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| |||||| ||| ||||||||||||| ||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
10046657 |
ttaactgatggccaaggaagaactgtggattttaggaacacagtcattatcatgacctcaaacctcggcgccgatcatctcataagtggactttcaggaa |
10046756 |
T |
|
| Q |
142 |
aatgtaccatgcaagttgctcacgatcgagtaatgcaggaagtaa |
186 |
Q |
| |
|
| ||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
10046757 |
attgtaccatgcaagttgctcgcgaccgagtaatgctggaagtaa |
10046801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 88 - 186
Target Start/End: Original strand, 38708308 - 38708406
Alignment:
| Q |
88 |
ttatcatgacctcgaaccttggcgctgatcatctccaaagtggactttcaggaaaatgtaccatgcaagttgctcacgatcgagtaatgcaggaagtaa |
186 |
Q |
| |
|
||||||||||||| |||||||| || || |||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38708308 |
ttatcatgacctcaaaccttggtgccgagcatctcataagtggactttcaggaaaatgcaccatgcaagttgctcgtgatcgagtaatgcaggaagtaa |
38708406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 33 - 186
Target Start/End: Original strand, 45468309 - 45468462
Alignment:
| Q |
33 |
gatgggagtttaactgatggacaaggcagaactgtggattttacgaacacggtcgttatcatgacctcgaaccttggcgctgatcatctccaaagtggac |
132 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||||||||| ||||| || | ||||||||||| |||||||| ||||| |||||| ||||||| |
|
|
| T |
45468309 |
gatgggaggttgactgacggacaaggcagaactgtggattttagaaacactgtgatcatcatgacctctaaccttggtgctgagcatctcttgagtggac |
45468408 |
T |
|
| Q |
133 |
tttcaggaaaatgtaccatgcaagttgctcacgatcgagtaatgcaggaagtaa |
186 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
45468409 |
tttcaggaaaatgtaccatgcaagctgctcgcgatcgagtgatgcaggaagtaa |
45468462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University