View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7980_high_15 (Length: 224)
Name: NF7980_high_15
Description: NF7980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7980_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 2963738 - 2963534
Alignment:
| Q |
1 |
ggctcttagaggaccactaaatttgcccaatatttaatcgtccacaaccattcaacttaaaagctacaaatcattccaggaccatcttcaaaagcaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2963738 |
ggctcttagaggaccactaaatttgcccaatatttaatcgtccacaaccattcaacttaaaagctacaaatcattcctggaccatcttcaaaagcaagat |
2963639 |
T |
|
| Q |
101 |
caccaaatgtagcccccaaataaaaagataactctctaacccannnnnnnnnatccggcagctgtttagttagtagcatgaagcgagattttaaggtgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
2963638 |
caccaaatgtagcccccaaataaaaagacaactttctaaccca-ttttttttatccggcagctggttagttagtagcatgaagcgagattttaaggtgtc |
2963540 |
T |
|
| Q |
201 |
tctttt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
2963539 |
tctttt |
2963534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University