View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7980_high_16 (Length: 219)

Name: NF7980_high_16
Description: NF7980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7980_high_16
NF7980_high_16
[»] chr1 (1 HSPs)
chr1 (18-204)||(13030434-13030620)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 13030434 - 13030620
Alignment:
18 agcagagtcaaatactggttttcattatggtgatatgaattcatcgttgaattggcatgcaatatcatttgaatctggtggtgttgttagtagcttgcct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13030434 agcagagtcaaatactggttttcattatggtgatatgaattcatcgttgaattggcatgcaatatcatttgaatctggtggtgttgttagtagcttgcct 13030533  T
118 gagatggttccaatgggaaattattttgggttgaacaatgatacttctgggatgatgatgtattcggggaattcaggtgttgttaat 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
13030534 gagatggttccaatgggaaattattttgggttgaacaatgatacagctgggatgatgatgtattcggggaattcaggtgttgttaat 13030620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University