View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7980_high_18 (Length: 204)
Name: NF7980_high_18
Description: NF7980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7980_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 185
Target Start/End: Original strand, 8947920 - 8948081
Alignment:
| Q |
23 |
tgtaaccaggaatatacaaggcgcaattagaagaaaaagtctaaaaagaactacatatataacctcaaaaatatattaaaacttgagtaatgatgtttgt |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8947920 |
tgtaaccaggaatatacaaggtgcaattagaa-aaaaagtctaaaaagaactacatatataacctcgaaaatatattaaaacttgagtaatgatgtttgt |
8948018 |
T |
 |
| Q |
123 |
acaattatttgcaacgatgtcagggttgaaagtaaattttcataaaagtgcgctggtgggtat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8948019 |
acaattatttgcaacgatgtcagggttgaaagtaaattttcataaaagtgcgctggtgggtat |
8948081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University