View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7980_low_10 (Length: 279)
Name: NF7980_low_10
Description: NF7980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7980_low_10 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 109 - 279
Target Start/End: Original strand, 683904 - 684074
Alignment:
| Q |
109 |
ctcaatcaggatgggaaaggcgatgttgctgacacctttgaggttagaatttctactatggatttacctcccctgcagtcaaattacacgcattagggac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
683904 |
ctcaatcaggatgggaaaggcgatgttgctgacacctttgaggttagaatttctactatggatttacctcccctgcagtcaaattacacgcattcgggac |
684003 |
T |
|
| Q |
209 |
attagtgatcgttcaatcgagatcggacaaactaaattcaaactcattagtttaaatgatcaatatcggac |
279 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
684004 |
attagtgatcgttcaatcgagatcagacaaactaaattcaaactcattagtttaaatgatcaatatcggac |
684074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 683815 - 683843
Alignment:
| Q |
20 |
agtatatactaataagatattgattctga |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
683815 |
agtatatactaataagatattgattctga |
683843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University