View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7980_low_15 (Length: 242)
Name: NF7980_low_15
Description: NF7980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7980_low_15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 37036587 - 37036359
Alignment:
| Q |
18 |
ctcttattacattctctagttacatttgctatgagaaattgatacatcatgcataagcatgccactgttttaatactagcctgaaccaaatcgcaaatac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37036587 |
ctcttattacattctctagttacatttgctatgagaaattgatacatcatgcacaagcatgccactgttttaatactagcctgaaccaaatcgcaaatac |
37036488 |
T |
|
| Q |
118 |
cttgactgcataaatgtaacgagcc----nnnnnnnnnnnnnnnnnctcaatcatcagtgatacttgatagtacattttaagggaataagatttgttgca |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37036487 |
cttgactgcataaatgtaacgagccaaaaaaaaaaaaaaaaaaaaactcaatcatcagtgatacctgatagtacattttaagtgaataagatttgttgca |
37036388 |
T |
|
| Q |
214 |
ctgaagtttcctacatcccccaacattta |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37036387 |
ctgaagtttcctacatcccccaacattta |
37036359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University