View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7981_low_3 (Length: 312)
Name: NF7981_low_3
Description: NF7981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7981_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 4776693 - 4776410
Alignment:
| Q |
1 |
tggaatattgatgttattcttgttgttttcatcatgaacatgatgaaaagtttggcttgtgaaagagtttgttttggtaggtctttgggattttggtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776693 |
tggaatattgatgttattcttgttgttttcatcatgaacatgatgaaaagtttggctagtgaaagagtttgttttggtaggtctttgggattttggtttg |
4776594 |
T |
|
| Q |
101 |
atgaaatgttgagggattgagcttatgccactttcagctaaggcttggactctaatcactggctctggccaaccttcactagccatcattttttgtgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776593 |
atgaaatgttgagggattgagcttatgccactttcagctaaggcttggactctaatcactggctctggccaaccttcactagccatcattttttgtgtgt |
4776494 |
T |
|
| Q |
201 |
tttgcactagctttttaggttgttatataagaatatttaatgctcttaagaaaaataaaagagatatattactggaggggacct |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776493 |
tttgcactagctttttaggttgttatataagaatatttaatgctcttaagaaaaataaaagagatatattactggaggggacct |
4776410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 25179645 - 25179685
Alignment:
| Q |
112 |
agggattgagcttatgccactttcagctaaggcttggactc |
152 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
25179645 |
agggattgaggttaggccactttcagctaaggcttggactc |
25179685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University