View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7981_low_7 (Length: 226)
Name: NF7981_low_7
Description: NF7981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7981_low_7 |
 | |
|
| [»] scaffold0267 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 33639986 - 33639793
Alignment:
| Q |
18 |
atatgtagaggaatgttttgctgaagcttctcgttaggtgatctcacaatgtctcttcccgttcttcttcctgatctcattgtggaaa-catatcatggc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
33639986 |
atatgtagaggaatgttttgctgaagcttctcgttaggtgatctcacaatgtctcttcccgttcttcttcctgatctcagtgtggaaatcatatcatggc |
33639887 |
T |
|
| Q |
117 |
ttccgttgaagcccgtcgtgagattcaaatgtgtttctaaacactatcaatcaatcatttccgacccaaaatttgcaaaacttcaccttcaaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33639886 |
ttccgttgaagcccgtcgtgagattcaaatgtgtttctaaacactaccaatcaatcatttccgacccaaaatttgcaaaacttcaccttcaaag |
33639793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 210
Target Start/End: Original strand, 3836138 - 3836211
Alignment:
| Q |
137 |
agattcaaatgtgtttctaaacactatcaatcaatcatttccgacccaaaatttgcaaaacttcaccttcaaag |
210 |
Q |
| |
|
|||||||||||||| || ||||||||| | ||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
3836138 |
agattcaaatgtgtatccaaacactataattcactcatttccgaccctgaattcacaaaacttcaccttcaaag |
3836211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0267 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0267
Description:
Target: scaffold0267; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 136 - 210
Target Start/End: Original strand, 11646 - 11720
Alignment:
| Q |
136 |
gagattcaaatgtgtttctaaacactatcaatcaatcatttccgacccaaaatttgcaaaacttcaccttcaaag |
210 |
Q |
| |
|
||||||||||||||| || ||||||||| | ||| |||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
11646 |
gagattcaaatgtgtatccaaacactataattcactcatttccaaccctgaattcacaaaacttcaccttcaaag |
11720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University