View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7984_high_16 (Length: 216)
Name: NF7984_high_16
Description: NF7984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7984_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 200
Target Start/End: Complemental strand, 43169239 - 43169051
Alignment:
| Q |
12 |
aatatttcacctcctttgccggtttttagtaatggattgaaacctatggttgatgggaattctctgttgaatggtggaaccgaaggtccttccccaggta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43169239 |
aatatttcacctcctttgccggtttttagtaatggattgaaacctatggttgatgggaattctctgttgaatggtggaaccgaaggtccttccccaggta |
43169140 |
T |
|
| Q |
112 |
aaaacagtccatcaggtggatctgggaacactggtgaagatacgaagggaggctcaaattcaagtccaagtgattcggttgaaacgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43169139 |
aaaacagtccatcaggtggatctgggaacactggtgaagatatgaagggaggctcaaattcaagtccaagtgattcggttgaaacgaaa |
43169051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University