View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7985_low_12 (Length: 235)
Name: NF7985_low_12
Description: NF7985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7985_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 43934494 - 43934721
Alignment:
| Q |
18 |
caagtggtgctaatcaagtggctagaaactgaatgagattcttcccccggaaaaaggaaaatggaagtacctcaattatcatatttcacat--------- |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43934494 |
caagtggtgctaatcaagtggctagaaactgaatgagattcttcccccggaaaaaggaaaatggaagtacctcaattatcatatttcacataaaagtaaa |
43934593 |
T |
|
| Q |
109 |
--------tttcttcactaggttgagataattcctttaaattaaatagac-aagttaacgtggttgattgtgctctaattagagtcgtctcatcacaatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43934594 |
tgcaacattttcttcactaggttgagataattcctttaaattaaatagaccaagttaacgtggttgattgtgctctaattagagtcgcctcatcacaatc |
43934693 |
T |
|
| Q |
200 |
tcgttgttcgttatttattgatattctt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43934694 |
tcgttgttcgttatttattgatattctt |
43934721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University