View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7985_low_15 (Length: 218)
Name: NF7985_low_15
Description: NF7985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7985_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 15 - 135
Target Start/End: Original strand, 3238797 - 3238917
Alignment:
| Q |
15 |
aatatgaatatgcatgattaaactttggtcatnnnnnnntgaataattaaatattgtacacaattatgaattcaataaaagggatgagttcaatgcatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3238797 |
aatatgaatatgcatgattaaactttggtcataaaaaaatgaataattaaatattgtacacaattatgaattcaataaaagggattagttcaatgcatgt |
3238896 |
T |
 |
| Q |
115 |
gatttaagaggaacctttcct |
135 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3238897 |
gatttaagaggaacctttcct |
3238917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 120 - 201
Target Start/End: Original strand, 3238935 - 3239016
Alignment:
| Q |
120 |
aagaggaacctttcctatattagtctataatatgaatgattgaagattggtatttgattataagaatacaaagatgattaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238935 |
aagaggaacctttcctatattagtctataatatgaatgattgaagattggtatttgattataagaatacaaagatgattaat |
3239016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University