View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7986_low_1 (Length: 267)
Name: NF7986_low_1
Description: NF7986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7986_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 20618223 - 20618467
Alignment:
| Q |
20 |
cctagcccttcaatgatgactcatactatatgctctcagtgtctctctattttggttccgtttacaatggtcaagttcaactaaaatgacctacaactc- |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20618223 |
cctagcccttcaatgatgactcatactatatgctctcagtgtctctctattttggttccgtttacaatggtcaagttcaactaaaatgacctacaactct |
20618322 |
T |
 |
| Q |
119 |
-tttatatagatgttttgaaatgttaagttcgcca-gcaagacctggttttcctagaaaatcaaggtttcttcaacaaagggaaaatccagatgtcttca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20618323 |
atttatatagatgttttgaaatgttaagttcgctaggcaagacctggttttcctagaaaatcaaggtttcttcaacaaagggaaaatccagatgtcttca |
20618422 |
T |
 |
| Q |
217 |
aa-nnnnnnnngatccgccttagttctctatgaacaccaaactcg |
260 |
Q |
| |
|
|| ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
20618423 |
aatatttttttgatccgccttagttctctaggaagaccaaactcg |
20618467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University