View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_high_17 (Length: 386)
Name: NF7987_high_17
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 26 - 367
Target Start/End: Original strand, 29838442 - 29838779
Alignment:
| Q |
26 |
agcagagagtatcagatggtatgtaccaagtaatactacaaaatgattggtaaatgcttgcaaatcgtgtataaatggtgacaaccgcgtaataacttga |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29838442 |
agcagagagtatcagatggtatgtaccaagtaatactacaaaaagattggtaaatgcttgcaaatcgcgtataaatggtgacaaccgcgtaataacttga |
29838541 |
T |
|
| Q |
126 |
cattatcaaatgatcttgtttcttctgtgtgcttctgtgatcgtgcatgcgtgcatgtacatttaatgactagtaattgctaatttgtcgcaataggcaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838542 |
cattatcaaatgatcttgtttcttctgtgtgcttctgtgatcgtgcatgcgtgcatgtacatttaatgactagtaattgctaatttgtcgcaataggcaa |
29838641 |
T |
|
| Q |
226 |
attaaactgaaaagtagttaatatattctttcnnnnnnnnnngttccattttgccacaatccgataatgtgaaatttaatcttttggtatcgactgatag |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29838642 |
attaaactgaaaagtagttaatatattcttt----tttttttgttccattttgccacaatccgataatgtgaaatttaatcttttggtatcgactaatag |
29838737 |
T |
|
| Q |
326 |
aaagcagacgaacttctattgatatcttcttaaaggcttctg |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838738 |
aaagcagacgaacttctattgatatcttcttaaaggcttctg |
29838779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University