View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_high_20 (Length: 377)
Name: NF7987_high_20
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_high_20 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 118; Significance: 4e-60; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 94920 - 94760
Alignment:
| Q |
18 |
gaaggactatactatatgtcttggtaatatatttattgtcatcattatagttattgtcgttatagcactagcctctatata--tatagaagcttactata |
115 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| |||| |
|
|
| T |
94920 |
gaagggctatactatacgtcttggtaatatatttattgtcatcattatagttattgtcgttattgcactagcttctatatatatatagaagcttattata |
94821 |
T |
 |
| Q |
116 |
gcatctcaaatgcttgagtttgcaaaatggactattcggtttccttctctaaagcccaaat |
176 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
94820 |
gcatcgcaaatgcttgagtctgcaaaatggactattcggtttgcttctctaaagcccaaat |
94760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University