View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_high_39 (Length: 252)
Name: NF7987_high_39
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 22 - 241
Target Start/End: Original strand, 41567303 - 41567522
Alignment:
| Q |
22 |
ccgccaccattccaccgcttgcaacaacctccaaatctcaaccggcggtggagctgcttcgatatggcacgcgattactccttgcggcggcgacggattc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567303 |
ccgccaccattccaccgcttgcaacaacctccaaatctcaaccggcggtggagctgcttcgatatggcacgcgattactccttgcggcggcgacggattc |
41567402 |
T |
|
| Q |
122 |
cgaaccggcggtgtgatgcttcatcatgaccacgaactcaaaggtgaaggatcgtggaacgttgcttgggatgctcgtcctgctagatggcttcatcgtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567403 |
cgaaccggcggtgtgatgcttcatcatgaccacgaactcaaaggtgaaggatcgtggaacgttgcttgggatgctcgtcctgctagatggcttcatcgtt |
41567502 |
T |
|
| Q |
222 |
ccgactccgcttggcttctt |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41567503 |
ccgactccgcttggcttctt |
41567522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University