View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_high_45 (Length: 241)
Name: NF7987_high_45
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_high_45 |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] chr4 (105 HSPs) |
 |  |
|
| [»] chr2 (96 HSPs) |
 |  |
|
| [»] chr1 (107 HSPs) |
 |  |
|
| [»] chr8 (76 HSPs) |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |
|
| [»] chr6 (61 HSPs) |
 |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |
|
| [»] scaffold0524 (1 HSPs) |
 |  |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0674 (1 HSPs) |
 |  |  |
|
| [»] scaffold0077 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 97)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 5117363 - 5117297
Alignment:
| Q |
111 |
tattttaaaagatatatatttgagcggaaattaaacatgtttttaccaacattccttataattgtcc |
177 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5117363 |
tattttaaaagatatgtattttagcggaaattaaacatgtttttaccaacattccttataattgtcc |
5117297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 48315017 - 48315069
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcattatccttacca |
48315069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 8113552 - 8113607
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
8113552 |
gtggtggccgggattcgaaccgcggatcttgcatatattatgcattgtccttacca |
8113607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 53996370 - 53996315
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccatacca |
53996315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 52119446 - 52119392
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttacca |
52119392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21513359 - 21513304
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||||||| ||||||||| |
|
|
| T |
21513359 |
gtggtggctgggattcgaaccccagaccttgcataaattatgcattgtccttacca |
21513304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 28130924 - 28130979
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
28130924 |
gtggtgtccgggattcaaaccccagaccttgcatatattatgcattgtccttacca |
28130979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 38130949 - 38131004
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
38130949 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
38131004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 46469347 - 46469293
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
46469347 |
gtggtggccgggattcgaaccccg-accttgaatatattatgcattgtccttacca |
46469293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 51614280 - 51614225
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
51614280 |
gtggtgtccgggattcgaacctcggaccttgcatatattttgcattattcttacca |
51614225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 198 - 241
Target Start/End: Original strand, 53633619 - 53633662
Alignment:
| Q |
198 |
attcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53633619 |
attcgaaccccggaccttacatatattatgcattatccttacca |
53633662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 55066590 - 55066645
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
55066590 |
gtggtggccgggatttgaaccccagaccatgcatatattatgcattatccgtacca |
55066645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 22251450 - 22251495
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
22251450 |
gtggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 25727957 - 25728002
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25727957 |
gtggtggtcgggatttgaaccccggaccttgcatatattatgcatt |
25728002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 48849753 - 48849798
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
48849798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 201 - 241
Target Start/End: Complemental strand, 28266772 - 28266732
Alignment:
| Q |
201 |
cgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28266772 |
cgaaccccggaccttgcatatattatgcattgtccttacca |
28266732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 47039498 - 47039446
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||||||||||| |||||| |
|
|
| T |
47039498 |
gtggtggtcgggattcgaaccccgaactttgcatatattatgcattgtcctta |
47039446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 8747228 - 8747271
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
8747228 |
ggtggccggtattcgaaccccggaccttacatatattatgcatt |
8747271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 10926540 - 10926485
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
10926540 |
gtggtggccgacatttgaaccccgaaccttgcatatattatgcattgtccttacca |
10926485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 14771402 - 14771355
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
14771402 |
gtggtgtccgggattcgaacctcagaccttgcatatattatgcattat |
14771355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 16663242 - 16663281
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16663242 |
gaaccccggaccttgcatatattatgcattatccatacca |
16663281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 25340914 - 25340969
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
25340914 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccatacca |
25340969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 25441490 - 25441545
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccatacca |
25441545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 45432019 - 45431964
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| || || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctacca |
45431964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 17588424 - 17588378
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
17588424 |
gggattcgaaccccagatcttgcatatattatgcattgtccttacca |
17588378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 19468521 - 19468467
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
19468521 |
tggtgtcccggattcgaaccacggaccttgcatatattatgcattgtccatacca |
19468467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 25902838 - 25902796
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
25902838 |
ttcgaaccccagaccttgcatatattatacattatccttacca |
25902796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 33771760 - 33771706
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||| ||||||||| |
|
|
| T |
33771760 |
tggtggccgggattcaaaccgtggaccttgcatatattatacattgtccttacca |
33771706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 35191820 - 35191862
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35191820 |
ttcgaaccccagaccttgcatatattatgcattgtccttacca |
35191862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 44582796 - 44582750
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
44582796 |
gtggtggccggggttcgaaccccggaccttgcatattattatgcatt |
44582750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 48376901 - 48376851
Alignment:
| Q |
191 |
ggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
48376901 |
ggccgggattcgaaccccaaaccttacatatattatgcattatctttacca |
48376851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 334837 - 334882
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
334837 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 4601915 - 4601870
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
4601915 |
gtggtggccggggtttgaaccccggaccttgcatttattatgcatt |
4601870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 21331407 - 21331452
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21331407 |
gtggcggccgagattcgaaccccgaaccttgcatatattatgcatt |
21331452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 25505692 - 25505744
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
25505692 |
gtggtgtccggg-ttcgaaccccagaccttgcatatattatgcattgtccttac |
25505744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 25730473 - 25730428
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
25730473 |
gtggtggccggggttcgaaccccagaccttgtatatattatgcatt |
25730428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 32909291 - 32909336
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
32909291 |
gtggtggccgggatttgaacccaggaccttgcatattttatgcatt |
32909336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 200 - 241
Target Start/End: Original strand, 39822176 - 39822217
Alignment:
| Q |
200 |
tcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
39822176 |
tcgaaccccggaccttgtatatattatgcattgtccttacca |
39822217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 241
Target Start/End: Original strand, 39869803 - 39869852
Alignment:
| Q |
192 |
gccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
39869803 |
gccgagattcgaacctcggaccttgtatatattatgcattgtccttacca |
39869852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 45334260 - 45334215
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
45334260 |
gtggtggtcgggatttgaaccccgaaccttgcatatattatgcatt |
45334215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 194 - 239
Target Start/End: Complemental strand, 52491514 - 52491469
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52491514 |
cggggttcgaacagcggaccttgcatatattatgcattatccttac |
52491469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 52576018 - 52575973
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
52576018 |
gtggtggtcgggattcgaaccccagaccttgcatattttatgcatt |
52575973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 11969647 - 11969695
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
11969647 |
ccggaattcgaacctcggaccttgcatgtattatgcattttccttacca |
11969695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 13829068 - 13829112
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13829068 |
tggtggcaggggttcgaaccccagaccttgcatatattatgcatt |
13829112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 34899167 - 34899123
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
34899167 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
34899123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 35126266 - 35126314
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
35126266 |
ccgggatttgaaccccagatcttgcatatattatgcattatccctacca |
35126314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 44579700 - 44579652
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
44579700 |
ccggggttcgaaccccggaccttgcatattttatgcattgtccatacca |
44579652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 54230096 - 54230144
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
54230096 |
ccggggttcgaaccccaaaccttgcatatattatgcattgtccttacca |
54230144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 1149059 - 1149114
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| || || ||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
1149059 |
gtggtgtccagggttcgaaccctagaccttgcatatattatgcattgtccttacca |
1149114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 7464481 - 7464536
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
7464481 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctacca |
7464536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 23147976 - 23148023
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
23147976 |
cggggttcgaaccccggacctcgcatatattatgtattgtccttacca |
23148023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 27143117 - 27143062
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||||||||| |||| ||||||||| |
|
|
| T |
27143117 |
gtggtgtccgggattcgaaccctagaccttacatatattatacattgtccttacca |
27143062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 237
Target Start/End: Original strand, 28879883 - 28879934
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
||||||||| ||||||||||| | |||||||| ||||||||||||| ||||| |
|
|
| T |
28879883 |
gtggtggccaggattcgaaccacagaccttgcgtatattatgcattgtcctt |
28879934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 29631257 - 29631202
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||| |||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
29631257 |
gtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccatacca |
29631202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 35863803 - 35863858
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| | || ||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
35863803 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttacca |
35863858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 196 - 231
Target Start/End: Original strand, 40575609 - 40575644
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40575609 |
ggatttgaaccccggaccttgcatatattatgcatt |
40575644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 46483318 - 46483263
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| ||||||| |||||| |||||||||||||||||| ||| ||||| |
|
|
| T |
46483318 |
gtggtggctggggttcgaactccggactttgcatatattatgcattgtccatacca |
46483263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 238
Target Start/End: Original strand, 47099034 - 47099077
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
47099034 |
gggatttgaaccccgaaccttgcatatattatgcattattctta |
47099077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 51882190 - 51882245
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||| ||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
51882190 |
gtggtggccggggtttgaaccctggatcttgcatatattatgcattgtccatacca |
51882245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 53365975 - 53365940
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatat |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53365975 |
gtggtggccgggatttgaaccccggaccttgcatat |
53365940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 916510 - 916460
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
916510 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
916460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 5349598 - 5349544
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| || || ||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
5349598 |
tggtggccagggtttgaacctcggaccttgcatatataatgcattgtccttacca |
5349544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 231
Target Start/End: Original strand, 14160275 - 14160313
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
14160275 |
ccggggttcgaaccccggactttgcatatattatgcatt |
14160313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 20671846 - 20671888
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
20671846 |
ttcgaaccccggaccgtgcatgtattatgcattgtccttacca |
20671888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 21914074 - 21914116
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
21914074 |
ttcgaaccccataccttgcatatattatgcattgtccttacca |
21914116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 32629138 - 32629096
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
32629138 |
ttcgaaccccggaccttgcatattttatgcattgtccatacca |
32629096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 44075146 - 44075196
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
44075196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 53208028 - 53207986
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
53208028 |
ttcgaaccccagaccttgcatatattatgcattgcccttacca |
53207986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 913606 - 913635
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
913606 |
gaaccccggaccttgcatatattatgcatt |
913635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 241
Target Start/End: Original strand, 977941 - 977986
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
977941 |
ggatttgaactccggaccttgcatatattatgcattgtccatacca |
977986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 4760178 - 4760133
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| |||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
4760178 |
gtggtgaccgggattcgaatctcagaccttgcatatattatgcatt |
4760133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 4825410 - 4825365
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| || | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
4825410 |
gtggtggtcgaggttcgaaccccggacctttcatatattatgcatt |
4825365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 8075856 - 8075811
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcatt |
8075811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 8238635 - 8238590
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcatt |
8238590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 10440755 - 10440710
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
10440755 |
gtggtggtcggaattcgaacctcgtaccttgcatatattatgcatt |
10440710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 240
Target Start/End: Original strand, 10457093 - 10457146
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
|||||||||||||| ||||| | |||||| ||||||| ||||||| |||||||| |
|
|
| T |
10457093 |
tggtggccgggatttgaacctctgaccttacatatataatgcattgtccttacc |
10457146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 11358305 - 11358264
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
11358305 |
gtggtggccggggtttgaaccccggatcttgcatatattatg |
11358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 16792964 - 16793009
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
16792964 |
gtggtgaccggggtttgaaccctggaccttgcatatattatgcatt |
16793009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 17507689 - 17507734
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| || |||||| |||| ||||||||||||||||||||| |
|
|
| T |
17507689 |
gtggtggcccgggttcgaatcccgaaccttgcatatattatgcatt |
17507734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 21925762 - 21925717
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21925762 |
gtggtggtcgggattcgaaccccaaaccttgcctatattatgcatt |
21925717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 27432305 - 27432260
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27432305 |
gtggtggccggaattcgaaccccataccttacatatattatgcatt |
27432260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 28244102 - 28244139
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
28244102 |
cggggttcgaaccccggaccttgcatattttatgcatt |
28244139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 32843252 - 32843297
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||| ||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcatt |
32843297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 235
Target Start/End: Original strand, 37920988 - 37921037
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||| |||||||| ||||| | ||| |||||||||||||||||||||| |
|
|
| T |
37920988 |
gtggtgtccgggatttgaaccgcagacattgcatatattatgcattatcc |
37921037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 233
Target Start/End: Original strand, 39408264 - 39408301
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
39408264 |
ggattcgaaccccagaccttgcatatattatacattat |
39408301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 41817554 - 41817525
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41817554 |
gaaccccggaccttgcatatattatgcatt |
41817525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 238
Target Start/End: Complemental strand, 45096098 - 45096045
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| | ||| |||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
45096098 |
agtggtgtctggggttcgaaccacagaccttgcatatattatgcattgtcctta |
45096045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 46226023 - 46226060
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
46226023 |
cggggttcgaactccggaccttgcatatattatgcatt |
46226060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 48656905 - 48656934
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48656905 |
gaaccccggaccttgcatatattatgcatt |
48656934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 48796208 - 48796253
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||| ||||||||||| ||||||||| |
|
|
| T |
48796208 |
gtggtggccggggtttgaaccccgaaccttgcatatcttatgcatt |
48796253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 235
Target Start/End: Complemental strand, 52456552 - 52456503
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||| | || ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
52456552 |
gtggtggtcagggttcgaaccccggaccttacatattttatgcattatcc |
52456503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 4216390 - 4216441
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||| || || ||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4216390 |
gtggtgtccagggttcgaaccccg-accttgcatatattatgcattgtcctta |
4216441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 8139779 - 8139731
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||||||| ||| ||||| |
|
|
| T |
8139779 |
ccggaattcgaacctcagaccttgcatatattatgcattgtccatacca |
8139731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 238
Target Start/End: Complemental strand, 8957999 - 8957963
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
8957999 |
gaaccccgaaccttgcatatattatgcattgtcctta |
8957963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 16980347 - 16980399
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||| ||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
16980347 |
gtggtcgggatttgaaccatgaaccttgcatatattatgcattgtccttacca |
16980399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 32303418 - 32303386
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
32303418 |
ttcgaaccccggaccttgcgtatattatgcatt |
32303386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 48511302 - 48511266
Alignment:
| Q |
205 |
ccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
48511302 |
ccccggaccttgcatatattatgcattgtccctacca |
48511266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 75396 - 75341
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttacca |
75341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 105)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 56497598 - 56497653
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
56497598 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccttacca |
56497653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 53190365 - 53190311
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
53190365 |
tggtgggcgggattcgaaccctggaccttgcatatattatgcattatccatacca |
53190311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 3936698 - 3936653
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcatt |
3936653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 7230351 - 7230296
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttacca |
7230296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 10006411 - 10006356
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||| || |||||| |
|
|
| T |
10006411 |
gtggtggccggtattcgaaccccagaccttgcatatattatgcattgtctttacca |
10006356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 19908763 - 19908708
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
19908763 |
gtggtggtcggggttcgaacctcggaccttgcatatattatgcattgtccttacca |
19908708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 24664981 - 24665036
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
24664981 |
gtggtggtcggggttcgaaccccggaccttgcatatattatgcattctccatacca |
24665036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 49473716 - 49473661
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49473716 |
gtggtgactggggttcgaaccccggaccttgcatatattatgcattgtccttacca |
49473661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 49949404 - 49949350
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
49949404 |
gtggtggccgggattcgaacccag-accttgcatatattatgcattgtccttacca |
49949350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 56551582 - 56551637
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
56551582 |
gtggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttacca |
56551637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 18915037 - 18915091
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||||||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
18915037 |
tggtggtcgggattcgaaccccggaccatgaatatattatgcattgtccttacca |
18915091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 25978388 - 25978335
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||| | |||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
25978388 |
gtggtgtctgggattcgaacctcggaccttgcatatattatgcattgtccttac |
25978335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 200 - 241
Target Start/End: Original strand, 46676502 - 46676543
Alignment:
| Q |
200 |
tcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46676502 |
tcgaaccccggaccttgcatatattatgcattgtccttacca |
46676543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 49041971 - 49042016
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
49042016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 7371539 - 7371590
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
7371539 |
tggtgtccggggttcgaaccccggaccttgcatatattatgtattgtcctta |
7371590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 8027387 - 8027442
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
8027387 |
gtggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttacca |
8027442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 11949753 - 11949808
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
11949753 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
11949808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 23304006 - 23304061
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
23304006 |
gtggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctacca |
23304061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 229
Target Start/End: Original strand, 42316814 - 42316857
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42316814 |
gtggtgaccgggattcgaacctcggaccttgcatatattatgca |
42316857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 228
Target Start/End: Complemental strand, 11198399 - 11198357
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgc |
228 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
11198399 |
gtggtggccggggtttgaaccccggaccttgcatatattatgc |
11198357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 38416119 - 38416073
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
38416119 |
gggattcgaacctcataccttgcatatattatgcattatccttacca |
38416073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 202 - 236
Target Start/End: Complemental strand, 44815996 - 44815962
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44815996 |
gaaccccggaccttgcatatattatgcattatcct |
44815962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 238
Target Start/End: Original strand, 49952663 - 49952713
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
49952663 |
ggtggccgggatttgaaccactgaccttgcatatattatgcattgtcctta |
49952713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 200 - 241
Target Start/End: Original strand, 6789430 - 6789471
Alignment:
| Q |
200 |
tcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
6789430 |
tcgaaccccggaccttgcatatactatgcattgtccttacca |
6789471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 17320168 - 17320213
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
17320168 |
gtggtggcggggattcgaaccacggaccttacatatattatgcatt |
17320213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 35287497 - 35287542
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
35287497 |
gtggtggccggggttggaaccccggaccttgcatattttatgcatt |
35287542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 37921817 - 37921764
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||| |||||| || ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
37921817 |
gtggtagccggggtttgaatcccggaccttgcatatattatgcattgtccttac |
37921764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 38453336 - 38453291
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
38453336 |
gtggtggctggggttcgaaccctggaccttgcatatattatgcatt |
38453291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 238
Target Start/End: Original strand, 50650916 - 50650969
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||| ||||||||||||||||| | ||||| ||||||||||||||| |||||| |
|
|
| T |
50650916 |
agtggaggccgggattcgaaccctgaaccttacatatattatgcattgtcctta |
50650969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 54294412 - 54294457
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
54294412 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 54857605 - 54857650
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
54857605 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
54857650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 1432927 - 1432887
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattat |
226 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1432927 |
gtggtggtcgagattcgaaccccggaccttgcatatattat |
1432887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 10303504 - 10303556
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
10303504 |
gtggccgaggttcgaaccccggatcttgcatattttatgcattgtccttacca |
10303556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 19479468 - 19479512
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
19479512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 24785459 - 24785507
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
24785459 |
ccggggttcgaaccccagaccttgtatatattatgcattgtccttacca |
24785507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 24822807 - 24822759
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
24822807 |
ccggggttcgaaccccagaccttgtatatattatgcattgtccttacca |
24822759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 34834009 - 34834041
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34834009 |
ttcgaaccccggaccttgcatatattatgcatt |
34834041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 2649723 - 2649778
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| || ||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
2649723 |
gtggtggctagggttcgaactccggaccttgcatatattatgcattgtccctacca |
2649778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 6087817 - 6087770
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatc |
234 |
Q |
| |
|
||||||| ||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
6087817 |
tggtggctggggtttgaaccccagaccttgcatatattatgcattatc |
6087770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 8495058 - 8495003
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| |||| | ||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
8495058 |
gtggtggccgggatttgaactcgggatcttgcatatattatgcattgtccctacca |
8495003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 9946498 - 9946443
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
9946498 |
gtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccatacca |
9946443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 14577501 - 14577552
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| || |||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
14577501 |
tggccggggtttgaactccggactttgcatatattatgcattgtccttacca |
14577552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 15988488 - 15988433
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| || | |||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
15988488 |
gtggtggtcgaggttcgaaccccggaccttgtatatagtatgcattgtccttacca |
15988433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 16470375 - 16470320
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
16470375 |
gtggtggtcggggttcgaaccctggaccttgcatattttatgcattgtccatacca |
16470320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 19588225 - 19588170
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
19588225 |
gtggtggccggggtttgaaccctggaccttgcatattttatgcattgtccatacca |
19588170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 19854636 - 19854581
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||| | ||||||||||||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
19854636 |
gtggtgtccgaggttcgaaccccggatcttgcatatattatgcattgtccatacca |
19854581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 20383543 - 20383504
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
20383543 |
gaaccccggaccttgcatatattatgcattgtccatacca |
20383504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 20799400 - 20799439
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
20799400 |
gaaccccggaccttgcatatattatgcattgtccctacca |
20799439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 21114295 - 21114350
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
21114295 |
gtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtccatacca |
21114350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 23775589 - 23775534
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
23775589 |
gtggtggttggggttcgaaccctggaccttgcatatattatgcattgtccctacca |
23775534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 25783455 - 25783494
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
25783455 |
gaaccccggaccttgcatatattatgcattgtccctacca |
25783494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 28435238 - 28435293
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| || |||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
28435238 |
gtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtccatacca |
28435293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 29908111 - 29908072
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29908111 |
gaactccggaccttgcatatattatgcattgtccttacca |
29908072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 30380601 - 30380546
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
30380601 |
gtggtggtcggaattcgaaccccaaaccttgcatatattatacattgtccttacca |
30380546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 36071215 - 36071160
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| ||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
36071215 |
gtggtgcccggcgttcgaaccccgaaccttacatatattatgcattgtccttacca |
36071160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 38375028 - 38374973
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||| || |||||||||||||||||||||| ||| ||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccctacca |
38374973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 43027362 - 43027315
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatc |
234 |
Q |
| |
|
||||| |||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43027362 |
tggtgtccgggattcgaaccatgaaccttgcatatattatgcattatc |
43027315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 43034332 - 43034387
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||| | |||||||||||||||||||||| ||| ||||| |
|
|
| T |
43034332 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccatacca |
43034387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 47806254 - 47806301
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
47806254 |
cggggttcgaaccccagaccttgcatatattatgcattgtcctcacca |
47806301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 50442738 - 50442792
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| | ||||||||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
50442738 |
gtggtgtctgggattcgaacccag-accttgcatatattatgcattatccctacca |
50442792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 52270020 - 52270075
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
52270020 |
gtggtggctgggattcgaggcccagaccttgcatatattatgcattgtccatacca |
52270075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 55061108 - 55061053
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||| ||| ||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
55061108 |
gtggtggtcggaatttgaacccccgaccttgcatatattatgcattgtccgtacca |
55061053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 227
Target Start/End: Complemental strand, 10035337 - 10035295
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
10035337 |
agtggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 10261759 - 10261809
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
10261759 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
10261809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 12698657 - 12698623
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
12698657 |
gattcgaaccccagaccttgcatatattatgcatt |
12698623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 235
Target Start/End: Original strand, 14202472 - 14202518
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||| |||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcattatcc |
14202518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 237
Target Start/End: Original strand, 14542763 - 14542801
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
14542763 |
ttcgaaccccagaccttgcatatattatgcattgtcctt |
14542801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 16304089 - 16304143
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| | || ||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtccatacca |
16304143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 21562696 - 21562646
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
21562696 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
21562646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 26926700 - 26926750
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
26926700 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
26926750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 27655802 - 27655757
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
27655802 |
agtggtggccggggttcgaacccag-accttgcatatattatgcatt |
27655757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 224
Target Start/End: Complemental strand, 32139411 - 32139373
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatatt |
224 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
32139411 |
gtggtgtccggggttcgaaccccggaccttgcatatatt |
32139373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 237
Target Start/End: Complemental strand, 42845079 - 42845045
Alignment:
| Q |
203 |
aaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42845079 |
aaccccggaccttgcatatattatgcattgtcctt |
42845045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 43330217 - 43330167
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
43330217 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
43330167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 227
Target Start/End: Original strand, 47814244 - 47814282
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatg |
47814282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 48955350 - 48955308
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
48955350 |
ttcgaaccccggactttgcatatattacgcattgtccttacca |
48955308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 237
Target Start/End: Complemental strand, 49308878 - 49308840
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
49308878 |
ttcgaaccccagaccttgcatatattatgcattgtcctt |
49308840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 50906145 - 50906099
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
50906145 |
agtggtggtagggattcggatcccggaccttgcatatattatgcatt |
50906099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 51450283 - 51450233
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
51450283 |
gtggtggccggggtttgaactccggaccttgcatatcttatgcattgtcct |
51450233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 56204997 - 56204963
Alignment:
| Q |
207 |
ccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
56204997 |
ccggaccttgcatatattatgcattgtccttacca |
56204963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 675973 - 675944
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
675973 |
gaaccccggaccttgcatatattatgcatt |
675944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 2888945 - 2888900
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || ||||| ||||||||||||||||||| |||| |
|
|
| T |
2888945 |
gtggtggccggggtttgaaccgcggaccttgcatatattatacatt |
2888900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 3580785 - 3580740
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
3580785 |
gtggtgtccggggttcgaatcccagaccttgcatatattatgcatt |
3580740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 7967615 - 7967668
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||| | |||||||||| ||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
7967615 |
gtggtgtctgggattcgaatcccagactttgcatatattatgcattatctttac |
7967668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 11144655 - 11144700
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
11144655 |
gtggtgtccggggttcaaaccccagaccttgcatatattatgcatt |
11144700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 240
Target Start/End: Complemental strand, 12058365 - 12058336
Alignment:
| Q |
211 |
accttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12058365 |
accttgcatatattatgcattatccttacc |
12058336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 241
Target Start/End: Original strand, 13264272 - 13264325
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||| |||||| ||||| ||||| |
|
|
| T |
13264272 |
ggtgtccggggttcgaaccccggtccttgcatataatatgcaatatccctacca |
13264325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 17423183 - 17423212
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17423183 |
gaaccccggaccttgcatatattatgcatt |
17423212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 235
Target Start/End: Complemental strand, 36035889 - 36035856
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
36035889 |
gaaccccggaccttggatatattatgcattatcc |
36035856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 42139913 - 42139860
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| || ||||||||||| |||||| ||||||||||| ||| ||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgtccatacca |
42139860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 42756107 - 42756148
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
42756107 |
gattcgaatcccgaaccttgcatatattatgcattgtcctta |
42756148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 43078739 - 43078698
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
43078739 |
gtggtggccgggattcgaatcctggatcttgcatatattatg |
43078698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 49953409 - 49953438
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49953409 |
gaaccccggaccttgcatatattatgcatt |
49953438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 1701667 - 1701635
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
1701667 |
ttcgaacctcggaccttgcatatattatgcatt |
1701635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 10497319 - 10497275
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| ||| ||||| |
|
|
| T |
10497319 |
gattcgaaccccggactttgcatattttatgcattgtccatacca |
10497275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 16737133 - 16737097
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
16737133 |
gggatttgaacccccgaccttgcatatattatgcatt |
16737097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 21052554 - 21052602
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||| ||||| |
|
|
| T |
21052554 |
ccgggattcgaacctcataccttgcatatattatgtattatccatacca |
21052602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 21318242 - 21318298
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||| || |||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
21318242 |
agtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctacca |
21318298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 29568657 - 29568605
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||| | ||| |||||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
29568657 |
gtggtgtctggggttcgaacctcggaccttacatatattatgcattgtcctta |
29568605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 235
Target Start/End: Complemental strand, 32779426 - 32779386
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32779426 |
gggattcaaaccccggaccctgcatatattacgcattatcc |
32779386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 34247488 - 34247456
Alignment:
| Q |
209 |
ggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
34247488 |
ggaccttgcatatattatgcattgtccttacca |
34247456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 37255006 - 37254974
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
37255006 |
ttcgaaccccggaccttacatatattatgcatt |
37254974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 48226495 - 48226543
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||| |||||||||||| ||||||||| ||| ||||| |
|
|
| T |
48226495 |
ccgggatttgaaccccagaccttgcatattttatgcattgtccatacca |
48226543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 51298686 - 51298726
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattat |
226 |
Q |
| |
|
|||||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
51298686 |
gtggtgtccgggattcaaaccccgaaccttgcatatattat |
51298726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 54151634 - 54151670
Alignment:
| Q |
205 |
ccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
54151634 |
ccccggactttgcatatattatacattatccttacca |
54151670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 96)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 20455962 - 20455907
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccatacca |
20455907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 41778934 - 41778979
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41778934 |
gtggtggccgggattcgaacctcggaccttgcatatattatgcatt |
41778979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 2257042 - 2256987
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtccatacca |
2256987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 4056861 - 4056806
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4056861 |
gtggtgcccgagattcgaactccggaccttgcatatattatgcattgtccttacca |
4056806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 6579275 - 6579326
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
6579275 |
tggccgggattcgaaccccagaccttgcatatattatgcattgttcttacca |
6579326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 20120711 - 20120766
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
20120711 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattgtccttacca |
20120766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21258687 - 21258632
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||| || |||||| |
|
|
| T |
21258687 |
gtggtggccgggattcgaaccccagaccttgcatatatcatgcattgtctttacca |
21258632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 21482509 - 21482564
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| ||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21482509 |
gtggtggtcggggttcaaaccccggaccttgcatatattatacattatccttacca |
21482564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 229
Target Start/End: Complemental strand, 27411163 - 27411120
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27411163 |
gtggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 29544698 - 29544643
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
29544698 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctacca |
29544643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 29809397 - 29809342
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||| ||| ||||| |
|
|
| T |
29809397 |
gtggtggccgggattcgaaccccgtacctttcatatattatgcattgtccctacca |
29809342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 12124603 - 12124561
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12124603 |
ttcgaaccccggaccttgcatatattatgcattgtccttacca |
12124561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 24593434 - 24593392
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24593434 |
ttcgaaccccggaccttgcatatattatgcattgtccttacca |
24593392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 27848229 - 27848184
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
27848229 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 10735821 - 10735865
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
10735821 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 16390674 - 16390630
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
16390674 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 7772466 - 7772505
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7772466 |
gaactccggaccttgcatatattatgcattatccttacca |
7772505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 10156088 - 10156033
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
10156088 |
gtggtggtcgggattcgaacaccgaaccttgcatatattatgtattgtccttacca |
10156033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 15654860 - 15654914
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
15654860 |
gtggtgtccggg-ttcgaaccccagaccttgcatattttatgcattatccttacca |
15654914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 24592836 - 24592891
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
24592836 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctacca |
24592891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 27152424 - 27152369
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| || || |||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
27152424 |
gtggtgtcctgggttcgaaccccagaccttgcatatattatgcattatccctacca |
27152369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 28771653 - 28771598
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
28771653 |
gtggtgtccggggttcgaaccgcggatcttgcatatattatgcattgtccttacca |
28771598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 31477042 - 31476987
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||||||||| ||| ||||| |
|
|
| T |
31477042 |
gtggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctacca |
31476987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 31543067 - 31543028
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31543067 |
gaaccccggaccttgcatatattatgcattatccatacca |
31543028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 31815877 - 31815932
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctacca |
31815932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 5137808 - 5137850
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
5137808 |
ttcgaaccccggaccttgcatatattatacattgtccttacca |
5137850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 12124742 - 12124700
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12124742 |
ttcgaactccggaccttgcatatattatgcattgtccttacca |
12124700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 42791363 - 42791321
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcatt |
42791321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 16221336 - 16221381
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
16221336 |
gtggtggcggggattcgaaccccgaaccttgcatattttatgcatt |
16221381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 20200776 - 20200731
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
20200776 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcatt |
20200731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 25186232 - 25186277
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
25186232 |
gtggtggctggggtttgaaccccggaccttgcatatattatgcatt |
25186277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 33064057 - 33064012
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
33064057 |
gtggtggccggagttcgaactccggaccttgcatatattatgcatt |
33064012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 36474833 - 36474788
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
36474833 |
gtggtggccggaatttgaaccccggaccttgcatattttatgcatt |
36474788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 12231925 - 12231893
Alignment:
| Q |
209 |
ggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12231925 |
ggaccttgcatatattatgcattatccttacca |
12231893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 24393316 - 24393264
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||| ||||| |||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcattgtcctta |
24393264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 25598556 - 25598607
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
25598556 |
gtggccggg-ttcgaaccctggaccttgcatatattatgcattgtccatacca |
25598607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 41853435 - 41853391
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
41853435 |
tggtggccggggttcgaacgccggaccttacatatattatgcatt |
41853391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 4122003 - 4122058
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||| |||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
4122003 |
gtggaggccgggatttaaaccccagaccttgcatatattatgcattgtccatacca |
4122058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10724011 - 10723964
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcatta |
232 |
Q |
| |
|
||||||||||||| || ||||| | ||||||||||||||||||||||| |
|
|
| T |
10724011 |
agtggtggccggggtttgaacctcagaccttgcatatattatgcatta |
10723964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 19179048 - 19179095
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||| ||||||||| |
|
|
| T |
19179048 |
cgggattcgaagcgcagaccttgcatatattatgcattgtccttacca |
19179095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 20017046 - 20017101
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
20017046 |
gtggtggccgagatttgaactccggaccttgcatatataatgcaatgtccttacca |
20017101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 20565081 - 20565120
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
20565081 |
gaaccccggaccttgcatatattatgcattgtccctacca |
20565120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 21558812 - 21558851
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
21558812 |
gaacctcggaccttgcatatattatgcattgtccttacca |
21558851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 22523002 - 22523057
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||| ||| ||| ||||| |
|
|
| T |
22523002 |
gtggtggccgggatttgaacctcgaaccttgcatatattatgtattgtccatacca |
22523057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 23250310 - 23250365
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
23250310 |
gtggtggtcggggtttgaaccctggaccttgcatatattatgcattgttcttacca |
23250365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 24548082 - 24548027
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| || || |||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
24548082 |
gtggtgtccagggttcgaaccccggaccttgaatatattatggattgtccttacca |
24548027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 30978417 - 30978378
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
30978417 |
gaacccctgaccttgcatatattatgcattatccatacca |
30978378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 34903588 - 34903533
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||| | |||||||||||||||||||| | ||||||||| |
|
|
| T |
34903588 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcactgtccttacca |
34903533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 35820291 - 35820346
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| | || |||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
35820291 |
gtggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtccctacca |
35820346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 36264469 - 36264524
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
36264469 |
gtggtggtcggggtttgaaccccgaactttgcatatattatgcattatccatacca |
36264524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 39770516 - 39770571
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||| ||||||||| |
|
|
| T |
39770516 |
gtggtggccgggattcgaactcataaccttacatatattatgcattgtccttacca |
39770571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 41187447 - 41187502
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||||||||| |||||||| ||||||||| ||| ||||| |
|
|
| T |
41187447 |
gtggtgaccggggttcgaaccccggactttgcatattttatgcattgtccatacca |
41187502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 42066783 - 42066728
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
42066783 |
gtggtggccgaggttcaaaccccggaccttgcatatattgtgcattgtccatacca |
42066728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 660813 - 660867
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| || |||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtccatacca |
660867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 3708764 - 3708714
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
3708764 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
3708714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 4180765 - 4180719
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||| |||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
4180765 |
gtggtcggggtttgaaccccggaccttgcatattttatgcattatcc |
4180719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 240
Target Start/End: Original strand, 8091164 - 8091202
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
8091164 |
gaaccccggaccttgcatatattatgcattgtccatacc |
8091202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 11868652 - 11868702
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
11868652 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
11868702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 235
Target Start/End: Complemental strand, 20239407 - 20239365
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20239407 |
ccgggattcgaaccttagaccttgcatatattatgcattatcc |
20239365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 22709153 - 22709111
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
22709111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 30089119 - 30089065
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| | || ||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctacca |
30089065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 30125723 - 30125669
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| | || ||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctacca |
30125669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 34977274 - 34977220
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgtccatacca |
34977220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 35360045 - 35360095
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
35360045 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
35360095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 35685064 - 35685106
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35685064 |
ttcgaaccctagaccttgcatatattatgcattgtccttacca |
35685106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 41859922 - 41859868
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||| ||||||||| ||| ||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtccatacca |
41859868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 228
Target Start/End: Complemental strand, 42754116 - 42754074
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgc |
228 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
42754116 |
gtggtggccggggatcgaacctcggaccttgcatatattatgc |
42754074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 44526198 - 44526144
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| || ||| |||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgtatattatgcattgtccatacca |
44526144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 235
Target Start/End: Original strand, 5168585 - 5168618
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
5168585 |
gaaccccgaaccttgcatatattatgcattatcc |
5168618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 12599855 - 12599896
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
12599855 |
gtggtggtcggggttcgaaccccagaccttgcatatattatg |
12599896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 238
Target Start/End: Original strand, 16204814 - 16204859
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
16204814 |
ccgggatccaaaccccagaccttgcatatattatgcattgtcctta |
16204859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 19595468 - 19595513
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcat |
230 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||| |
|
|
| T |
19595468 |
gtggtggccggggttcgaaccccagaccttgcatattattatgcat |
19595513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 22571855 - 22571900
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| | |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22571855 |
gtggtggctgagatttgaaccccggacattgcatatattatgcatt |
22571900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 22607223 - 22607178
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
22607223 |
gtggtgtccggggctcgaaccccggaccttacatatattatgcatt |
22607178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 24016080 - 24016121
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggacc-ttgcatatattat |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
24016080 |
gtggtggccgagattcgaaccccggacctttgcatatattat |
24016121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 235
Target Start/End: Complemental strand, 29599994 - 29599961
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
29599994 |
gaaccccggaccttggatatattatgcattatcc |
29599961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 36359369 - 36359340
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36359369 |
gaaccccggaccttgcatatattatgcatt |
36359340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 44746618 - 44746573
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||| |||| |
|
|
| T |
44746618 |
gtggtggccggggttcgaaccccggactttgcatattttatacatt |
44746573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 44810776 - 44810735
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
44810776 |
gtggtggctggggtttgaaccccggaccttgcatatattatg |
44810735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 3113725 - 3113769
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
3113725 |
cgggatttgaatcccggaccttgcatattttatgcattgtcctta |
3113769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 201 - 241
Target Start/End: Complemental strand, 6141276 - 6141236
Alignment:
| Q |
201 |
cgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
6141276 |
cgaaccctagaccttgcatatattatgcattgtccttacca |
6141236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 7052845 - 7052789
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| || || |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
7052845 |
gtggtgtccggggtttgagccccggaccttgcatattattatgcattgtccttacca |
7052789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 8781643 - 8781695
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||| || ||||||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcattgtccatacca |
8781695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 234
Target Start/End: Complemental strand, 12619403 - 12619367
Alignment:
| Q |
198 |
attcgaaccccggaccttgcatatattatgcattatc |
234 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12619403 |
attcgaaccccagatcttgcatatattatgcattatc |
12619367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 13410711 - 13410667
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
13410711 |
cgggattcgaaccttggaccttgcatatattatgtattgtcctta |
13410667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 14925221 - 14925277
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggac-cttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||||||| |||| ||||||||| |
|
|
| T |
14925221 |
gtggtggctgggattcgaaccccgaacttttgcatatattatacattgtccttacca |
14925277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
|||||||||||| || |||| || ||||||||||||||||||||| |
|
|
| T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 19976225 - 19976169
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
||||||| || | |||||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
19976225 |
gtggtggtcgaggttcgaaccccggaccttgcatattattatgcattgtccatacca |
19976169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 21870885 - 21870941
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| ||||||||||| |||||||||| ||||||||||| ||| ||||| |
|
|
| T |
21870885 |
gtggtggtcggggttcgaaccccgaaccttgcatattattatgcattgtccatacca |
21870941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 24305296 - 24305340
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
24305296 |
tggtcgccgagattcgaaccccgaaccttgcatattttatgcatt |
24305340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 25274818 - 25274874
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| |||||||||| |||||| ||||||||||||||| | ||||||| |
|
|
| T |
25274818 |
agtggtgttcggggttcgaaccccagaccttacatatattatgcattgttcttacca |
25274874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 26427869 - 26427821
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatc |
234 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
26427869 |
gtggtggtcgggatttgagacccggaccttgcatatattatgtattatc |
26427821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 241
Target Start/End: Original strand, 32091172 - 32091216
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
32091172 |
gattcaaaccctagaccttgcatatattatgcattttccttacca |
32091216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 241
Target Start/End: Original strand, 40099385 - 40099428
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
40099385 |
gattcgaacctcg-accttgcatatattatgcattgtccttacca |
40099428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 41763867 - 41763923
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||| || |||||||||||| |||||||| |||||||| ||| ||||| |
|
|
| T |
41763867 |
agtgatggccggggtttgaaccccggaccgtgcatatactatgcattgtccatacca |
41763923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 43356545 - 43356577
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
43356545 |
ttcgaacctcggaccttgcatatattatgcatt |
43356577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 107)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 38448856 - 38448911
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38448856 |
gtggtgtccgggattcgaaccccggaccttgcatatattatgcattgtccttacca |
38448911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 47719097 - 47719152
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47719097 |
gtggtggccgggattcgaactccgaaccttgcatatattatgcattatccttacca |
47719152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 50638906 - 50638961
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
50638906 |
gtggtggccgggattcgaaccctggaccttgcatatattatgcattgtccttacca |
50638961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 40613094 - 40613039
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40613094 |
gtggtggtcgagattcgaaccccggaccttgcatatattatgcattgtccttacca |
40613039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 41973326 - 41973271
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccctacca |
41973271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 23405348 - 23405400
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23405348 |
gtggtggtcgggattcgaaccctggaccttgcatatattatgcattgtcctta |
23405400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 34595943 - 34595891
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattatcctta |
34595891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 127145 - 127090
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
127145 |
gtggtggccgggatttaaaccccggaccttgcatatataatgcattgtccttacca |
127090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 8210375 - 8210430
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
8210375 |
gtggtggccggggttcgaaccctggaccttgtatatattatgcattgtccttacca |
8210430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 35474023 - 35473968
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| ||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
35474023 |
gtggtgtccggggttcgaaccctgaaccttgcatatattatgcattatccttacca |
35473968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 45481551 - 45481509
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45481551 |
ttcgaaccccggaccttgcatatattatgcattgtccttacca |
45481509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 41763148 - 41763200
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcattatccctacca |
41763200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 8269358 - 8269413
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
8269358 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttacca |
8269413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 8736506 - 8736451
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccatacca |
8736451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 9639807 - 9639862
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||| | ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9639807 |
gtggtgtccgaggttcgaactccggaccttgcatatattatgcattgtccttacca |
9639862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 10356173 - 10356228
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
10356173 |
gtggtggccggagttcgaaccccggaccgtgcatatattatgcattgtccatacca |
10356228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 195 - 238
Target Start/End: Original strand, 10843320 - 10843363
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10843320 |
gggattcgaattccggaccttgcatatattatgcattatcctta |
10843363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 17284022 - 17283967
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| || || ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
17284022 |
gtggtgtccagggttcgaaccctggaccttgcatatattatgcattgtccttacca |
17283967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21638184 - 21638129
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
21638184 |
gtggtgtccggggttcgaaccccggaccttgcatatatcatgcattgtccgtacca |
21638129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 229
Target Start/End: Complemental strand, 24529756 - 24529713
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
24529756 |
gtggtggccgggattcgaaccccggaccttacatattttatgca |
24529713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 29042608 - 29042553
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||| |||||||||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
29042608 |
gtggtggtcgggatttgaaccccggatcttacatatattatgcattatccctacca |
29042553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 34521180 - 34521235
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
34521180 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccatacca |
34521235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 39949883 - 39949828
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| |||||||||||||| | ||||||| |
|
|
| T |
39949883 |
gtggtggtcgggattcgaaccccagaccttgtatatattatgcattgttcttacca |
39949828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 42888646 - 42888591
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
42888646 |
gtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccatacca |
42888591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 47528437 - 47528492
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
47528437 |
gtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttacca |
47528492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 49431983 - 49432030
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcattat |
49432030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 10132447 - 10132489
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
10132447 |
ttcgaaccccagaccttgcatatattatgcattgtccttacca |
10132489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 3481632 - 3481587
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
3481632 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 6809789 - 6809842
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
6809789 |
gtggtggccaagattcgaaccccagacattgcatatattatgcattgtccttac |
6809842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 12212364 - 12212311
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||| || ||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcattatccctacca |
12212311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 15382809 - 15382854
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
15382809 |
gtggtggccgggtttcgaacctcggaccttgcatatattatacatt |
15382854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 196 - 241
Target Start/End: Complemental strand, 24631900 - 24631855
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
24631900 |
ggattcgaaccttggatcttgcatatattatgcattatccttacca |
24631855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 25533038 - 25532989
Alignment:
| Q |
192 |
gccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
25533038 |
gccggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
25532989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 41884795 - 41884836
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
41884795 |
gtggtggccggggttcgaaccccggaccttgtatatattatg |
41884836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 44641598 - 44641553
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
44641598 |
gtggtggccaggatttgaaccccgggccttgcatatattatgcatt |
44641553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 235
Target Start/End: Complemental strand, 46392304 - 46392255
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
46392304 |
gtggtggtcggaatttgaaccccggaccttggatatattatgcattatcc |
46392255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 52441501 - 52441546
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
52441501 |
gtggtggccggggttcaaacgccggaccttgcatatattatgcatt |
52441546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 235
Target Start/End: Complemental strand, 782241 - 782193
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
782241 |
tggtggccggaattcgaaccccagatcttgcatatattatgcaatatcc |
782193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 9413862 - 9413814
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| | ||||||| |
|
|
| T |
9413862 |
ccgggattcgaaccccgaaccttacatatattatgcattgttcttacca |
9413814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 19620636 - 19620592
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19620636 |
gatttgaaccccggaccttgcatatattatgtattgtccttacca |
19620592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 238
Target Start/End: Original strand, 24124824 - 24124872
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||||||||||| |||||| |
|
|
| T |
24124824 |
tggccgggattcaaacctcgaaccttgcatatattatgcattgtcctta |
24124872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 24752637 - 24752693
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
24752637 |
gtggtggccggggttcgaaccccagaccttgcatattattatgcattgtccatacca |
24752693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 32561041 - 32560989
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacattgtccatacca |
32560989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 229
Target Start/End: Complemental strand, 5280702 - 5280659
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
5280702 |
gtggtggtcggggttcgaaccccagaccttgcatatattatgca |
5280659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 237
Target Start/End: Complemental strand, 5907870 - 5907819
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||||| ||||| || |||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
5907870 |
gtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtcctt |
5907819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 6000133 - 6000188
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| || ||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
6000133 |
gtggtgtccggggtttgaacctcggaccttgcatatattatgcattgtcctaacca |
6000188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 198 - 241
Target Start/End: Complemental strand, 12500982 - 12500939
Alignment:
| Q |
198 |
attcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
12500982 |
attcgaaccccgaactttgcatatattatgcattgtccttacca |
12500939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 17139507 - 17139562
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || ||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
17139507 |
gtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctacca |
17139562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 196 - 235
Target Start/End: Complemental strand, 22346737 - 22346698
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
22346737 |
ggatttgaaccccggaccttgcatattttatgcattatcc |
22346698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 238
Target Start/End: Original strand, 26256092 - 26256131
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
26256092 |
ttcgaaccccggatcttgcatatattatgcattaccctta |
26256131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 27533314 - 27533259
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
27533314 |
gtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctacca |
27533259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 29739392 - 29739353
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29739392 |
gaaccccggaccttgcatattttatgcattgtccttacca |
29739353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 29800588 - 29800549
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
29800588 |
gaacccccgaccttgcatattttatgcattatccttacca |
29800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 31092732 - 31092677
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||| ||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
31092732 |
gtggtggttgggattcaaactccagaccttacatatattatgcattatccttacca |
31092677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 32944807 - 32944752
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| |||||||||| ||| |||||||||||||||||| ||| ||||| |
|
|
| T |
32944807 |
gtggtggtcggggttcgaaccccagacgttgcatatattatgcattgtccatacca |
32944752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 196 - 235
Target Start/End: Complemental strand, 34485938 - 34485899
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
34485938 |
ggattcgaaccccagaccttacatatattatgcattatcc |
34485899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 233
Target Start/End: Complemental strand, 37050992 - 37050953
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37050992 |
cggggttcgaaccccggaccttgcatattttatgcattat |
37050953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 42045362 - 42045417
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||| || |||||||||||||||||||||| ||| ||||| |
|
|
| T |
42045362 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccatacca |
42045417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 238
Target Start/End: Complemental strand, 42416861 - 42416822
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42416861 |
ttcgaaccccaaaccttgcatatattatgcattatcctta |
42416822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 46707927 - 46707888
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46707927 |
gaaccccggaacttgcatatattatgcattgtccttacca |
46707888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 51067884 - 51067939
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||| |||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
51067884 |
gtggtggtcgggatttgaaccccgagccttgcatatattatgtattattcttacca |
51067939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 52043344 - 52043289
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||| |||||||| || |||||||| ||||||||||||| ||||| |
|
|
| T |
52043344 |
gtggtggtcgggatttgaaccccgaacattgcatattttatgcattatccatacca |
52043289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 241
Target Start/End: Original strand, 9872120 - 9872150
Alignment:
| Q |
211 |
accttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9872120 |
accttgcatatattatgcattatccttacca |
9872150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Original strand, 12268977 - 12269019
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
12269019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 15764090 - 15764048
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
15764090 |
ttcgaacccctgaccttgtatatattatgcattgtccttacca |
15764048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 241
Target Start/End: Original strand, 16580798 - 16580844
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| ||| ||||| |
|
|
| T |
16580798 |
gggattcgaaccccagaccttgcatatattatacattgtccatacca |
16580844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 17221523 - 17221565
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
17221523 |
ttcgaacctcggaccttgcatatattatgcattgttcttacca |
17221565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 225
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatatta |
225 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 224
Target Start/End: Original strand, 23730369 - 23730407
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatatt |
224 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
23730369 |
gtggtgtccggggttcgaaccccggaccttgcatatatt |
23730407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 31962517 - 31962463
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||||||||| ||| || ||||||||||||||| ||||||||| |
|
|
| T |
31962517 |
tggtggtcgggattcgaaccctagactttacatatattatgcattgtccttacca |
31962463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 33491156 - 33491110
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcatt |
231 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
33491156 |
gtggtggtcgggattcgaaccccgaaccttgcatattattatgcatt |
33491110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 241
Target Start/End: Original strand, 45418078 - 45418108
Alignment:
| Q |
211 |
accttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45418078 |
accttgcatatattatgcattatccttacca |
45418108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 48730642 - 48730684
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
48730642 |
ttcgagccccggaccttgcatttattatgcattgtccttacca |
48730684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 51370635 - 51370589
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| ||| || |||||||||||||||||| |||||||||| |
|
|
| T |
51370635 |
gggattcgaatcccagaacttgcatatattatgcatcatccttacca |
51370589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 4968621 - 4968650
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4968621 |
gaaccccggaccttgcatatattatgcatt |
4968650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 223
Target Start/End: Original strand, 6423751 - 6423788
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatat |
223 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |
|
|
| T |
6423751 |
gtggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 236
Target Start/End: Complemental strand, 10385350 - 10385309
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
||||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
10385350 |
gggattcaaactccgaaccttgcatatattatgcattatcct |
10385309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 14880899 - 14880854
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||| ||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
14880899 |
gtggttgccgggatttgaacctcagaccttgcatatattatgcatt |
14880854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 16033440 - 16033485
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcatt |
16033485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 234
Target Start/End: Complemental strand, 17249035 - 17248986
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatata-ttatgcattatc |
234 |
Q |
| |
|
|||||| | ||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
17249035 |
gtggtgtctgggattcgaacccgggaccttgcatatatttatgcattatc |
17248986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 28832161 - 28832206
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
28832161 |
gtggtggtcgggatttgaacctcagaccttgcatatattatgcatt |
28832206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 29251824 - 29251780
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
29251824 |
gtggtggccggg-ttcgaacctcagaccttgcatatattatgcatt |
29251780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 30798747 - 30798788
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
30798747 |
ggattcgaaccccggatcttacatatattatgcattgtcctt |
30798788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 34632240 - 34632195
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||||||| |||| |
|
|
| T |
34632240 |
gtggtggccgggatttgaacctcggatcttgcatatattatacatt |
34632195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 34808564 - 34808605
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
34808564 |
gattcgaacctcgaaccttgcatatattatgcattgtcctta |
34808605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 37045136 - 37045181
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| | ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
37045136 |
gtggtgtctggggttcgaaccctggaccttgcatatattatgcatt |
37045181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 241
Target Start/End: Original strand, 41677590 - 41677635
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||| ||||||||| |
|
|
| T |
41677590 |
ggattcgaaccccggatcttacatatattatgtattgtccttacca |
41677635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 235
Target Start/End: Original strand, 41769821 - 41769854
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
41769821 |
gaaccccggaccttggatatattatgcattatcc |
41769854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 235
Target Start/End: Complemental strand, 41974832 - 41974783
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||||||| || ||||| | ||||||||||||||||||||||||| |
|
|
| T |
41974832 |
gtggtggccggggtttgaacctcaaaccttgcatatattatgcattatcc |
41974783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 44678007 - 44678052
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| || ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
44678007 |
gtggtgaccaggatttgaaccccgaaccttgcatatattatgcatt |
44678052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 44732705 - 44732652
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||| |||||| ||||| ||||| |
|
|
| T |
44732705 |
ggtgtccggggttcgaaccccggcccttgcatataatatgcaatatccctacca |
44732652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 47961279 - 47961324
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
47961279 |
gtggtggctgggtttcaaacctcggaccttgcatatattatgcatt |
47961324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 3509950 - 3509986
Alignment:
| Q |
205 |
ccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
3509950 |
ccccggaccttgcatatattatgcattgtccatacca |
3509986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 5031144 - 5031196
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| |||||||||||| || ||| |||||||||||||| |||||| |
|
|
| T |
5031144 |
gtggtggccgatattcgaaccccgaactttgtatatattatgcattgtcctta |
5031196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 11462925 - 11462957
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
11462925 |
ttcgaaccccggaccttgcatattttatgcatt |
11462957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 13794522 - 13794550
Alignment:
| Q |
210 |
gaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13794522 |
gaccttgcatatattatgcattatcctta |
13794550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 23397326 - 23397358
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
23397326 |
ttcgaaccccggaccttgcatatgttatgcatt |
23397358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 23981068 - 23981100
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
23981068 |
ttcgaaccccggacattgcatatattatgcatt |
23981100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 238
Target Start/End: Original strand, 25498768 - 25498804
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
25498768 |
gaactccggaccttgcatatattatgcaatatcctta |
25498804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 28039857 - 28039905
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| ||| |||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
28039857 |
ccggggttcaaacctcagaccttgcatatattatgcattgtccttacca |
28039905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 231
Target Start/End: Original strand, 31401652 - 31401688
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |
|
|
| T |
31401652 |
gggattcgaatctcggaccttgcatatattatgcatt |
31401688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 31759904 - 31759932
Alignment:
| Q |
207 |
ccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31759904 |
ccggaccttgcatatattatgcattatcc |
31759932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 34599917 - 34599961
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
34599917 |
cgggattcgaaccccaaaccttatatatattatgcattatcctta |
34599961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 38000114 - 38000074
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
38000114 |
tggtggccggaattcgaaccccgaaccttacatatattatg |
38000074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 49875612 - 49875644
Alignment:
| Q |
209 |
ggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
49875612 |
ggaccttgcatatattatgcattgtccttacca |
49875644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 51429203 - 51429256
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
51429203 |
gtggtgtccggggttcgaaccccggacctagc--atattatgcattgtccttacca |
51429256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 52267832 - 52267780
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||| ||| ||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
52267832 |
gtggtcgggatttgaatcccagaccttgcatattttatgcattgtccttacca |
52267780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 79)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 32339806 - 32339761
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32339806 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
32339761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 3445237 - 3445292
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
3445237 |
gtggtggccgggatttgaaccccggaccttgcatacattatgcattgtccttacca |
3445292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 34702561 - 34702506
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34702561 |
gtggtggccaggattcgaaccccggacctttcatatattatgcattgtccttacca |
34702506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 6624847 - 6624802
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6624847 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcatt |
6624802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 16752492 - 16752547
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
16752492 |
gtggtggctgggattcgaaccccgaatcttgcatatattatgcattgtccttacca |
16752547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 22522791 - 22522846
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
22522791 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
22522846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 26655535 - 26655480
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
26655535 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccatacca |
26655480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 26927120 - 26927065
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
26927120 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccatacca |
26927065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 27679569 - 27679514
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
27679569 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattatctttacca |
27679514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 28207203 - 28207148
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
28207203 |
gtggtggccgggattcgaacctcggaccttgcatattttatgcattgtccatacca |
28207148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 37932401 - 37932346
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtccatacca |
37932346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 229
Target Start/End: Original strand, 25603991 - 25604033
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25603991 |
tggtggccgggattcgaaccccgaaccttgcatatattatgca |
25604033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 11017245 - 11017192
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
11017245 |
ggtgtccgggattcgaacctcagaccttgcatatattatgcattatccctacca |
11017192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 40715939 - 40715984
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
40715984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 237
Target Start/End: Complemental strand, 26590775 - 26590727
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
26590775 |
gtggccgggattcaaaccccagaccttgcatatattatgcattgtcctt |
26590727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 42708045 - 42708001
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
42708045 |
tggtggccgggattcgaatcccagaccttgcatatattatgcatt |
42708001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 6489078 - 6489023
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
6489078 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctacca |
6489023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 11647268 - 11647213
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
11647268 |
gtggtggtcaggattcgaaccccaaaccttgcatatattatgcattgtccttacca |
11647213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 14124372 - 14124317
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||| ||||| | |||| |||||||||||||| ||||||||| |
|
|
| T |
14124372 |
gtggtggccgggattcgatccccgaatcttgtatatattatgcattgtccttacca |
14124317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 17090937 - 17090882
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
17090937 |
gtggtggccggggtttgaaccccggaccttgcattaattatgcattatccatacca |
17090882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 35109471 - 35109416
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||| ||| || |||||| |
|
|
| T |
35109471 |
gtggtgtccgggattcgaacctcggaccttgcatatattatgtattgtctttacca |
35109416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 3052252 - 3052198
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
|||||||| |||||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
3052252 |
gtggtggctgggatttgaaccccaaaccttacatatattatgcattatccttacc |
3052198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 233
Target Start/End: Original strand, 5107236 - 5107282
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattat |
5107282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 26409323 - 26409269
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| ||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
26409323 |
tggtgggcggggttcgaaccccggaccttacatatattatgcattgtccatacca |
26409269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 39914970 - 39914917
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
39914970 |
tggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgtccttacca |
39914917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 3671282 - 3671237
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
3671282 |
ccggggttcgaaccctggaccttgcatatattatacattatcctta |
3671237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 18872738 - 18872693
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18872738 |
gtggtgaccaggattcgaaccccgaaccttgcatatattatgcatt |
18872693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 26030441 - 26030486
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
26030441 |
gtggtggccggggttcgaaccccggaccttgcaagtattatgcatt |
26030486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 35413027 - 35412983
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
35413027 |
gtggtggccggggttcgaaccc-ggaccttgcatatattatgcatt |
35412983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 4009938 - 4009882
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatatt-atgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
4009938 |
gtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttacca |
4009882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 8544979 - 8545031
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| ||| ||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
8544979 |
gtggtggtcggagttcgaactccggaccttgcatatattatgcattgtcctta |
8545031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 43108629 - 43108585
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
43108629 |
gattcgaaccctgaaccttgcatatattatgcattgtccttacca |
43108585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 11720964 - 11720910
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
11720964 |
gtggtggccggggtttgaaccccg-accttgcatatattatgcattgtccctacca |
11720910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 11844428 - 11844483
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
11844428 |
gtggtggtcgagattcgaaccctaaaccttgcatatattatgcattgtccttacca |
11844483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 16531265 - 16531320
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
16531265 |
gtggtgtccggaattcgaactatggaccttgcatatattatgcattgtccttacca |
16531320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 17046404 - 17046350
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
17046404 |
gtggtggccgggattcgaactc-ggatcttgcatatattatgcattgtccatacca |
17046350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 237
Target Start/End: Original strand, 17242678 - 17242721
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17242678 |
cggggttcgaaccgcggaccttgcatatactatgcattatcctt |
17242721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 18278253 - 18278304
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
18278253 |
tggccgggattcgaatttcggaccttgcatatattatgcattgttcttacca |
18278304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 18331778 - 18331723
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
18331778 |
gtggtggccggggcttgaaccccggaccttgcatattttatgcattgtccatacca |
18331723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 18391671 - 18391616
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| || | |||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18391671 |
gtggtggtcgaggttcgaacctcggaccttgcatattttatgcattgtccttacca |
18391616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 229
Target Start/End: Original strand, 26223592 - 26223635
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
26223592 |
gtggtggccgggatttgaaccccggaccttgtatatataatgca |
26223635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 26377037 - 26376982
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| |||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
26377037 |
gtggtgtccggagttcgaaccccggacgttgcatataatatgcattgtccttacca |
26376982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 28604408 - 28604463
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||| ||||||||||| || |||||| |
|
|
| T |
28604408 |
gtggtgtccgtgattcgaaccccggaccttacatttattatgcattgtctttacca |
28604463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 237
Target Start/End: Complemental strand, 29554925 - 29554882
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| ||||| |
|
|
| T |
29554925 |
cgggattcgaaccccgaaccttgcatgtattatgcattgtcctt |
29554882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 34436922 - 34436867
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || ||||||||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
34436922 |
gtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctacca |
34436867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 39980579 - 39980524
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||| ||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
39980579 |
gtggtggtcggggtttgaactccggaccttgcatattttatgcattatccatacca |
39980524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 42005176 - 42005121
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||| ||||| |||||| |||||||||||||||||||||| || |||||| |
|
|
| T |
42005176 |
gtggtgtccgagattcaaaccccagaccttgcatatattatgcattttcgttacca |
42005121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 42168935 - 42168990
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| | ||| |||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
42168935 |
gtggtgtctggggttcgaaccccagaccttgcatatactatgcattgtccttacca |
42168990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 233
Target Start/End: Original strand, 1476101 - 1476147
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
1476101 |
tggtgtccgggattcgaaccctgaaccttgcatatattatgaattat |
1476147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 5846099 - 5846045
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| ||||| || ||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
5846099 |
tggtgtccggggtttgaaccccagactttgcatatattatgcattgtccttacca |
5846045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 11637563 - 11637617
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||| ||||||||| ||| ||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgtccatacca |
11637617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 228
Target Start/End: Complemental strand, 14474905 - 14474863
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgc |
228 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
14474905 |
gtggtggccggggtttgaaccctggaccttgcatatattatgc |
14474863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 16089520 - 16089466
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||| |||||||||||| ||| ||||| |
|
|
| T |
16089520 |
tggtggccggggttcgaatcccagaccttgcaaatattatgcattgtccatacca |
16089466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 22499011 - 22498958
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| ||||| ||||||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
22499011 |
tggtgtccggggttcgaacccag-accttgcatatattatgcattgtccttacca |
22498958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 22745947 - 22745905
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
22745947 |
ttcgaacctcgtaccttacatatattatgcattatccttacca |
22745905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 224
Target Start/End: Original strand, 31958458 - 31958496
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatatt |
224 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
31958458 |
gtggtgtccggggttcgaaccccggaccttgcatatatt |
31958496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 34191501 - 34191459
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
34191459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 37462182 - 37462132
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
37462182 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
37462132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 42473962 - 42473920
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
42473962 |
gtggccgtggtttgaaccccggaccttgcatatattatgcatt |
42473920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 232
Target Start/End: Complemental strand, 7215812 - 7215775
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcatta |
232 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
7215812 |
gggattcgaaccccagaccttacatatattatgcatta |
7215775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 8350741 - 8350696
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8350741 |
gtggtggccgagattcgaaccctagactttgcatatattatgcatt |
8350696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 10227851 - 10227798
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
10227851 |
gtggtggccagggatcgaaccccggaccttgcatatttcatgcattgtccttac |
10227798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 13864415 - 13864374
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
13864415 |
gtggtggtcggggtttgaaccccggaccttgcatatattatg |
13864374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 20018042 - 20018087
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
20018042 |
gtggtggccgagattcgaaccccgaatcttgcatatgttatgcatt |
20018087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 20018223 - 20018268
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| |||| |||| |
|
|
| T |
20018223 |
gtggtggccgagattcgaacctcggaccttgcatatgttattcatt |
20018268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 21139154 - 21139183
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21139154 |
gaaccccggaccttgcatatattatgcatt |
21139183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 31708136 - 31708181
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
31708136 |
gtggtgtccgaggttcgaaccccagaccttgcatatattatgcatt |
31708181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 32200453 - 32200482
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32200453 |
gaaccccggaccttgcatatattatgcatt |
32200482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 32559375 - 32559330
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||||| ||||||||| |
|
|
| T |
32559375 |
gtggtggccgggatttgaaccccagaccttacatattttatgcatt |
32559330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 36683460 - 36683513
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||| | |||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
36683460 |
gtggtgtctgggattcgaaccccatatcttgcatatattatgcattgtccttac |
36683513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 43396925 - 43396880
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| |||||| |||||| ||||||||| ||||||||||||||| |
|
|
| T |
43396925 |
gtggtgtccgggaatcgaacaccggaccttacatatattatgcatt |
43396880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 9893661 - 9893709
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatc |
234 |
Q |
| |
|
|||||||| ||| || ||||||| |||||||||||| |||||||||||| |
|
|
| T |
9893661 |
gtggtggctggggtttgaaccccagaccttgcatattttatgcattatc |
9893709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 18589874 - 18589902
Alignment:
| Q |
203 |
aaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18589874 |
aaccccggaccttgcatatattatgcatt |
18589902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 241
Target Start/End: Original strand, 18981190 - 18981234
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| | ||||||| |
|
|
| T |
18981190 |
gattcgaaccccgaaccttacatatattatgcattgttcttacca |
18981234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 25607061 - 25607093
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
25607061 |
ttcgaaccccagaccttgcatatattatgcatt |
25607093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 25979914 - 25979870
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| | || ||||||||||||||||||| |||||||||| |
|
|
| T |
25979914 |
tggtggccgaggtttgaaccccggaccttgcatacattatgcatt |
25979870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 30329160 - 30329128
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
30329160 |
ttcgaaccccggaccttgcgtatattatgcatt |
30329128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 239
Target Start/End: Complemental strand, 32806417 - 32806377
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
32806417 |
ttcgaacttcggaccttgcatatattatgcattgtccttac |
32806377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 33928693 - 33928665
Alignment:
| Q |
203 |
aaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33928693 |
aaccccggaccttgcatatattatgcatt |
33928665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 83)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 48527261 - 48527209
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
48527261 |
gtggtggccgggattcgaactccggaccttgcatatattatgcattgtcctta |
48527209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 37624614 - 37624559
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcattgtccatacca |
37624559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 46987157 - 46987102
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46987157 |
gtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttacca |
46987102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 2962717 - 2962771
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
2962717 |
tggtggccgggattcaaaccccgaaccttgcatatattatgcattatctttacca |
2962771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 41029342 - 41029288
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacattgtccttacca |
41029288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 45425524 - 45425479
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45425524 |
gtggtggccgggattcgaaccccgaaccttgcatatattatgcatt |
45425479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 2618739 - 2618695
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2618739 |
gattcgaaccccggaccttgcatatattatgcattgtccttacca |
2618695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 22777350 - 22777401
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
22777350 |
gtggtggccgggattcgaaccccg-accttgcatatattatgcattgtcctta |
22777401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 8084498 - 8084443
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
8084498 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcattgtccatacca |
8084443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16198455 - 16198408
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcatta |
232 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16198455 |
agtggtggccgagattcgaactccggaccttgcatatattatgcatta |
16198408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21322246 - 21322191
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
21322246 |
gtggtggccggggtttgaaccctggaccttgcatacattatgcattatccttacca |
21322191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 27462426 - 27462481
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
27462481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 8290459 - 8290515
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
8290459 |
gtggtggtcgggattcgaaccccggaccttgcatattattatgcattgtccatacca |
8290515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 14671233 - 14671189
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14671233 |
cgggattcgaaccccggaccttgtatatattatgcattgtcctta |
14671189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 34000333 - 34000281
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||| ||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
34000333 |
gtggtggccggtatttgaaccccgaaccttacatatattatgcattatcctta |
34000281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 48837939 - 48837883
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||| |||||||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
48837939 |
agtggtggccggggttcgaaccccaaactttgcatatattatgcattatccatacca |
48837883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 7872738 - 7872793
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| || || |||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
7872738 |
gtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtccttacca |
7872793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 10244797 - 10244743
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
10244797 |
gtggtggccgggttt-gaaccccggaccttgcatatattatgcattgtccatacca |
10244743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 18714503 - 18714464
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18714503 |
gaaccccggaccttgcatatattatgcattgtccttacca |
18714464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 19416585 - 19416530
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
19416585 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccatacca |
19416530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 26973774 - 26973829
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26973774 |
gtggtgtccgggattcaaacgccggaccttacatatattatgcattaaccttacca |
26973829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 27833391 - 27833446
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
27833391 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttacca |
27833446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 238
Target Start/End: Complemental strand, 42336140 - 42336089
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
42336140 |
tggtggtcgagattcgaaccccggaccttgcatgtattatgcattgtcctta |
42336089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 37766926 - 37766872
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
||||| |||||||||| ||||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
37766926 |
gtggtagccgggattcaaaccccgtaccttgtatatattatgcattgtccttacc |
37766872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 194 - 239
Target Start/End: Complemental strand, 1046619 - 1046574
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
1046619 |
cgggattcgaaccccagaccttacatatattatgcattatctttac |
1046574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 19599214 - 19599161
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
19599161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 26009347 - 26009294
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
26009347 |
gtggtgtccggagttcgaaccccagaccttgcatatattatgcattttccttac |
26009294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 33610915 - 33610960
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
33610915 |
gtggtggccggtgttcgaactccggaccttgcatatattatgcatt |
33610960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 47155094 - 47155139
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
47155094 |
gtggtgtccggggttcgaaccctggaccttgcatatattatgcatt |
47155139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 394350 - 394394
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
394350 |
gtggtggccagtgttcgaaccccggaccttgcatatattatgcat |
394394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 5352397 - 5352345
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
5352397 |
gtggccgggattcgaatctcggaccttgtatatattatgtattgtccttacca |
5352345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 8883622 - 8883569
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||| ||| ||||| |
|
|
| T |
8883622 |
gtggtggccgggattcgaaccc--gaccttgcacatattatgcattgtccatacca |
8883569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 9522982 - 9522938
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcatt |
9522938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 22690026 - 22690078
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
22690026 |
gtggtgtccggggttcgaaccccaaaccttgcatatattatgcattattctta |
22690078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 37864493 - 37864441
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
37864493 |
gtggccgagagtcgaaccccagaccttgcatatattatgcattgtacttacca |
37864441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 39043815 - 39043771
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
39043815 |
gattcgaaccccggacctagcatatattatgcattgtccatacca |
39043771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 227
Target Start/End: Original strand, 40752830 - 40752870
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatg |
40752870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 238
Target Start/End: Complemental strand, 6384909 - 6384870
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
6384909 |
ttcgaaccccagaccttgcatatattatgcattgtcctta |
6384870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 14046601 - 14046656
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||| | |||||||||||||||||||| || ||||| |
|
|
| T |
14046601 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccatacca |
14046656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 14356631 - 14356686
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||| | |||||||||||||||||||| || ||||| |
|
|
| T |
14356631 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccatacca |
14356686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 20103444 - 20103499
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| | ||| |||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
20103444 |
gtggtgtctggggttcgaaccccggaccttgtaaatattatgcattgtccttacca |
20103499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21105674 - 21105619
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| |||||||| || ||||||||||||||||||||| ||| ||||| |
|
|
| T |
21105674 |
gtggtggtcggggttcgaacctcgaaccttgcatatattatgcattttccatacca |
21105619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 27545012 - 27544973
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
27545012 |
gaaccccggaccttgcatatattatacattgtccttacca |
27544973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 237
Target Start/End: Original strand, 33473511 - 33473562
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
||||||||| || || |||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
33473511 |
gtggtggccagggttggaaccctggaccttgcatatattatgcattgtcctt |
33473562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 37230034 - 37230073
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
37230034 |
gaaccccagaccttgcatatattatgcattttccttacca |
37230073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 37495909 - 37495956
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatc |
234 |
Q |
| |
|
|||||| ||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
37495909 |
tggtggtcgggatttgaaccttggaccttgcatatattatgcattatc |
37495956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 39280824 - 39280863
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
39280824 |
gaaccccggaccttgcatatattatgcattgttcttacca |
39280863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Original strand, 1079685 - 1079727
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1079685 |
gtggccgagatttgaaccccggaccttgcatattttatgcatt |
1079727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 1398385 - 1398442
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgc--atatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
1398385 |
gtggtgtccgggattcgaaccctggaccgtgcatatatattatgcattgtccttacca |
1398442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 8237623 - 8237677
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| || ||||| ||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
8237623 |
tggtggccggggtttgaacctcggactttgtatatattatgcattgtccttacca |
8237677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Original strand, 19626518 - 19626560
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcatt |
19626560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 20763225 - 20763175
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
20763225 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
20763175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 21050225 - 21050267
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
21050225 |
ttcgaaacccagaccttgcatatattatgcattgtccttacca |
21050267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 27263411 - 27263357
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||| ||||||| ||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
27263411 |
tggtggctggggttcgaactccgaaccttgcatatattatgcattgtccatacca |
27263357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 29237560 - 29237602
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
29237560 |
ttcgaaccctggaccttgcatatattatgcattgttcttacca |
29237602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 29488791 - 29488741
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
29488791 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
29488741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 33232387 - 33232437
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
33232387 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
33232437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 34284529 - 34284579
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
34284529 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
34284579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 46737853 - 46737811
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcatt |
46737811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 3830139 - 3830094
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
3830139 |
gtggtggctggggtttgaaccctggaccttgcatatattatgcatt |
3830094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 223
Target Start/End: Complemental strand, 5804832 - 5804795
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatat |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
5804832 |
gtggtggccggggttcgaaccctggaccttgcatatat |
5804795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 7670489 - 7670460
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7670489 |
gaaccccggaccttgcatatattatgcatt |
7670460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 8261433 - 8261478
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
8261433 |
gtggtggccgggattcgaaccccaaaccttacatattttatgcatt |
8261478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 241
Target Start/End: Complemental strand, 8615072 - 8615039
Alignment:
| Q |
208 |
cggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
8615072 |
cggaccttgcatatattatgcattgtccttacca |
8615039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 20085765 - 20085794
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20085765 |
gaaccccggaccttgcatatattatgcatt |
20085794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 25288735 - 25288690
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
25288735 |
gtggtggctgggatttgaactccggaccttgcatatcttatgcatt |
25288690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 31292759 - 31292804
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
31292759 |
gtggtggccggagttcgaaccccagaccttgcatgtattatgcatt |
31292804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 238
Target Start/End: Original strand, 34568331 - 34568375
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
34568331 |
ccgggattcgaactcca-accttgcatatattatgcattatcctta |
34568375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 230
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
36121720 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 42829224 - 42829269
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
42829224 |
gtggtggccggagtttgaaccccggagcttgcatatattatgcatt |
42829269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 45979184 - 45979143
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
45979184 |
gtggtggcttggattcgaaccccagaccttgcatatattatg |
45979143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 235
Target Start/End: Complemental strand, 46371036 - 46371003
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
46371036 |
gaaccccggaccttggatatattatgcattatcc |
46371003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 2648330 - 2648298
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
2648330 |
ttcgaaccctggaccttgcatatattatgcatt |
2648298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 2916166 - 2916118
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
2916166 |
ccggggttcgaatcccagaccttgcatatattatgcattgtccgtacca |
2916118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 6768698 - 6768742
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||| ||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
6768698 |
tggtgtccgagattcgaacctcagaccttgcatatattatgcatt |
6768742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 8227420 - 8227368
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||| || ||||||||||| |||| || ||||||||||||||| |||||| |
|
|
| T |
8227420 |
gtggtggtcgagattcgaaccctggactttacatatattatgcattgtcctta |
8227368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 20243327 - 20243271
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
20243327 |
gtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccatacca |
20243271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 25888952 - 25888916
Alignment:
| Q |
205 |
ccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25888952 |
ccccggaccttgcatatattatgcatcgtccttacca |
25888916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 38858169 - 38858205
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgca |
229 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
38858169 |
ccgggattcgaacctcggaccttacatatattatgca |
38858205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 40875100 - 40875068
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
40875100 |
ttcgaaccccggacattgcatatattatgcatt |
40875068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 230
Target Start/End: Original strand, 42095949 - 42095977
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42095949 |
gaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 46551831 - 46551871
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattat |
226 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
46551831 |
gtggtggccgagattcgaacctcggaccttgcatattttat |
46551871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 48629072 - 48629100
Alignment:
| Q |
203 |
aaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48629072 |
aaccccggaccttgcatatattatgcatt |
48629100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 76)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 196 - 241
Target Start/End: Complemental strand, 19778126 - 19778081
Alignment:
| Q |
196 |
ggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19778126 |
ggattcgaaccccggaccttgcatatattatgcattgtccttacca |
19778081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 444484 - 444429
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
444484 |
gtggtggccggggtttaaaccccggaccttgcatatattatgcattgtccttacca |
444429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 12748972 - 12748917
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
12748972 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
12748917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 15438524 - 15438469
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15438524 |
gtggtggctgagattcaaaccccggaccttgcatatattatgcattgtccttacca |
15438469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 15529828 - 15529773
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15529828 |
gtggtggctgagattcaaaccccggaccttgcatatattatgcattgtccttacca |
15529773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 27587292 - 27587237
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
27587292 |
gtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttacca |
27587237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 32051522 - 32051567
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
32051522 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
32051567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 4830076 - 4830024
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcattgtccatacca |
4830024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 34968622 - 34968571
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
34968622 |
gtggccgggattcgaaccccg-actttgcatatattatgcattatccatacca |
34968571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 1244695 - 1244750
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
1244695 |
gtggtgtccggggttcgaaccccagaccttgtatatattatgcattgtccttacca |
1244750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 7968931 - 7968985
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
7968931 |
gtggtggctgggatttgaaccc-ggaccttgcatatattatgcattgtccttacca |
7968985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 8881346 - 8881291
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgtccctacca |
8881291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 15147019 - 15147074
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
15147019 |
gtggtggtcgggatttgagccccggaccttgcatatattatgtattattcttacca |
15147074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 19488371 - 19488316
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
19488371 |
gtggtgtccgggattcgagccccagaccttgtatatattatgcattgtccttacca |
19488316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 24838160 - 24838215
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
24838160 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcctaacca |
24838215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 30623356 - 30623309
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
30623356 |
cggggttcgaaccccagaccttgcatatattatgcattgtccttacca |
30623309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 9067152 - 9067098
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||||||| | || |||||||| |||||||||||||||||||| |
|
|
| T |
9067152 |
tggtgtccgggattcgaacctcagatcttgcataaattatgcattatccttacca |
9067098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 23852982 - 23852928
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
23852982 |
gtggtgggcgggattcaaaccacggaccttgcatatattatgcattgtccatacc |
23852928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 27750907 - 27750949
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
27750907 |
ttcgaaccccggaccttgcatatattatgcactgtccttacca |
27750949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 45396635 - 45396585
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
45396635 |
gtggtggccgggattcgaacttcagaccttgcatatattatgcattgtcct |
45396585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 194 - 235
Target Start/End: Original strand, 7839116 - 7839157
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7839116 |
cgggattcgaaccccataccttgcatatattatgcattatcc |
7839157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 19260569 - 19260614
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
19260569 |
gtggtggccggggtttgaaccccggaccttacatatattatgcatt |
19260614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 38763505 - 38763550
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
38763505 |
gtggtggccagggttcgaaccccagaccttgcatatattatgcatt |
38763550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 40795448 - 40795407
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
40795448 |
gtggtggccggaattagaaccccggaccttgcatatattatg |
40795407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 239
Target Start/End: Original strand, 9635056 - 9635096
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
9635056 |
ttcgaaccccgaaccttgcatgtattatgcattatccttac |
9635096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 21557503 - 21557459
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
21557503 |
tggtggtcgggattcgaacctcggaccttacatatattatgcatt |
21557459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 30176409 - 30176453
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
30176409 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 37749990 - 37750034
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
37749990 |
tggtggccggggttcaaaccccggactttgcatatattatgcatt |
37750034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 6447260 - 6447205
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| | |||| |||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
6447260 |
gtggtggctgagatttgaactccggaccttgcatatattatgcattgtccatacca |
6447205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 12800890 - 12800945
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||||||| ||| ||| ||||| |
|
|
| T |
12800890 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccatacca |
12800945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 16869597 - 16869542
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||||||||||| ||| ||||| |
|
|
| T |
16869597 |
gtggtggccgggatttgaaccccgaactttgcaaatattatgcattgtccatacca |
16869542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 19163526 - 19163581
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
19163526 |
gtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccatacca |
19163581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 20275179 - 20275234
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| || |||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
20275179 |
gtggtggctggggtttgaaccccgaaccttgcatgtattatgcattgtccttacca |
20275234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 21061806 - 21061861
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| || |||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
21061806 |
gtggtggctggggtttgaaccccgaaccttgcatgtattatgcattgtccttacca |
21061861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 32192957 - 32192910
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
32192957 |
cggggttcgaaccccgaaccttgcatatattatgcattgtccatacca |
32192910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 37141428 - 37141373
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccatacca |
37141373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 37938558 - 37938511
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| ||||| ||||| |||||||||||||||||||||| ||||| |
|
|
| T |
37938558 |
cgggatttgaacctcggactttgcatatattatgcattatccatacca |
37938511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 42208475 - 42208514
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
42208475 |
gaacctcggaccttgcatatattatgcattgtccttacca |
42208514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 231
Target Start/End: Original strand, 1877659 - 1877697
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1877659 |
ccgggattcgaacccgtgaccttgcatatattatgcatt |
1877697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 7679962 - 7679928
Alignment:
| Q |
197 |
gattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7679962 |
gattcgaaccccgaaccttgcatatattatgcatt |
7679928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 8717466 - 8717520
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| | || |||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccatacca |
8717520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 9656000 - 9656042
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
9656000 |
ttcgaacctcggaccttgcatattttatgcattgtccttacca |
9656042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 11053044 - 11053002
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcatt |
11053002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Complemental strand, 13105152 - 13105110
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
13105152 |
ttcgaaccccggcccttgcatatattatgcattgtccctacca |
13105110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 20665353 - 20665403
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
20665353 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
20665403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 30550716 - 30550766
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
30550716 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
30550766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 240
Target Start/End: Original strand, 31832080 - 31832134
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
|||||| ||||| |||||| ||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
31832080 |
gtggtgtccggggttcgaaacccggacattgcatatattatgcattgtccctacc |
31832134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 44146795 - 44146749
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| |||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
44146795 |
agtggtgaccggaattcgaacctcgaaccttgcatatattatgcatt |
44146749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 44215465 - 44215515
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
44215465 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
44215515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 2554202 - 2554243
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
2554202 |
gtggtggccaggattcgaaccccagaccttgcatattttatg |
2554243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 3650591 - 3650546
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||| ||||| ||||||||||||||| |
|
|
| T |
3650591 |
gtggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 238
Target Start/End: Original strand, 6314312 - 6314365
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
6314312 |
agtggtggccggggttcgaatttcggaccttgcatattttatgcattgtcctta |
6314365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 6471582 - 6471537
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| || |||||||| || |||||||||||||||||| |
|
|
| T |
6471582 |
gtggtggccggggtttgaaccccgaacattgcatatattatgcatt |
6471537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 231
Target Start/End: Original strand, 13124357 - 13124398
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
13124357 |
tggccggggtttgaaccccggaccttgcatattttatgcatt |
13124398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 17898150 - 17898109
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
17898150 |
gtggtggccggggttagaatcccggaccttgcatatattatg |
17898109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 201 - 238
Target Start/End: Original strand, 19701349 - 19701386
Alignment:
| Q |
201 |
cgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
19701349 |
cgaaccccagaccttacatatattatgcattatcctta |
19701386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 235
Target Start/End: Original strand, 19733101 - 19733142
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19733101 |
cgggattcgaaccccgacccctgcatatattatgcattatcc |
19733142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 20469301 - 20469346
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
20469301 |
gtggtggctggggttcgaactccgaaccttgcatatattatgcatt |
20469346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 22775699 - 22775654
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| || || ||||||||||||||||||| |||||||||| |
|
|
| T |
22775699 |
gtggtggccagggtttgaaccccggaccttgcataaattatgcatt |
22775654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 22948071 - 22948116
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
22948071 |
gtggtggccagaatttaaaccccggaccttgcatatattatgcatt |
22948116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 232
Target Start/End: Original strand, 25277219 - 25277252
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
25277219 |
ttcgaaccccggaccttgcatattttatgcatta |
25277252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 33105446 - 33105417
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33105446 |
gaaccccggaccttgcatatattatgcatt |
33105417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 240
Target Start/End: Complemental strand, 44602655 - 44602614
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacc |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||| |||| |
|
|
| T |
44602655 |
ttcgaactccggaccttgcatatattatgcattgtccatacc |
44602614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 44975249 - 44975204
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
44975249 |
gtggtgtccgggtttcgaatcccgaaccttgcatatattatgcatt |
44975204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 230
Target Start/End: Original strand, 6235541 - 6235585
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
230 |
Q |
| |
|
|||||||||||| || ||| |||||||||| |||||||||||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcat |
6235585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 7380114 - 7380074
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatg |
227 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
7380114 |
tggtggccgggattcgaacccccaaccttgtatatattatg |
7380074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 8072786 - 8072754
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
8072786 |
ttcgaaccccggaccttgtatatattatgcatt |
8072754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 9241087 - 9241031
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||| || |||| |||||||| ||||||||||||||| | ||||||| |
|
|
| T |
9241087 |
agtggtggccggggtttgaacatcggaccttacatatattatgcattgtacttacca |
9241031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 18942982 - 18942934
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| || ||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
18942982 |
ccggggtttgaaacccggaccatgcatatattatgcattatccctacca |
18942934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 23816834 - 23816806
Alignment:
| Q |
213 |
cttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23816834 |
cttgcatatattatgcattatccttacca |
23816806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 27571840 - 27571884
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
27571840 |
tggtggtcgggatttgaaccccaaaccttgcatatattatgcatt |
27571884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 238
Target Start/End: Complemental strand, 28219914 - 28219882
Alignment:
| Q |
206 |
cccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28219914 |
cccggaccttgcaaatattatgcattatcctta |
28219882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 238
Target Start/End: Complemental strand, 33763874 - 33763834
Alignment:
| Q |
198 |
attcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
33763874 |
attcgaaccctgtaccttgcatatattatgcattgtcctta |
33763834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 37873047 - 37873003
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||| ||||||||| |
|
|
| T |
37873047 |
tggtggccggggttcgaaccacgtaccttgcatattttatgcatt |
37873003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 39076578 - 39076546
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39076578 |
ttcgaaccccggaccttgcatattttatgcatt |
39076546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 39077064 - 39077032
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39077064 |
ttcgaaccccggaccttgcatattttatgcatt |
39077032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 37605 - 37561
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37605 |
tggtggccgggattcgaaccccggaccttgcatattttatgcatt |
37561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 53767 - 53822
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
53767 |
gtggtgtccgggattcgaaccccggaccttgcatgtattatgcactgtccttacca |
53822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 61)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 2726407 - 2726462
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgtccatacca |
2726462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 8569780 - 8569725
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacca |
8569725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 12184579 - 12184532
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
12184579 |
gtggtggccgggatttgaaccacggaccttgcatatattatgcattat |
12184532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 14679196 - 14679141
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
14679196 |
gtggtggccgggattcgaaacccaaaccttgcatatattatgcattgtccttacca |
14679141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21847265 - 21847210
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||| ||| ||||| |
|
|
| T |
21847265 |
gtggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctacca |
21847210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 189 - 231
Target Start/End: Original strand, 655742 - 655784
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcatt |
655784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 4450333 - 4450288
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcatt |
4450288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 26587463 - 26587418
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26587463 |
gtggtggccgggattcgaacccagaaccttgcatatattatgcatt |
26587418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 9333802 - 9333747
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9333802 |
gtggtggccgagatttaaaccccggaccttgcatatataatgcattgtccttacca |
9333747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 237
Target Start/End: Original strand, 27907941 - 27907992
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcctt |
237 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
27907941 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattatcctt |
27907992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 29740553 - 29740498
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
29740553 |
gtggtggccggggtttgaaccccggaccttgcgtatattatgcattgtccatacca |
29740498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 238
Target Start/End: Complemental strand, 33824951 - 33824900
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||| | || |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtcctta |
33824900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 12215825 - 12215779
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| |||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12215825 |
agtgatggccgtgatttgaaccccggaccttgcatatattatgcatt |
12215779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 26400934 - 26400880
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||| ||| ||| ||||| |
|
|
| T |
26400934 |
tggtggccggggttcaaaccccggaccttgcatatattatgtattgtccatacca |
26400880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 194 - 231
Target Start/End: Complemental strand, 9111110 - 9111073
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9111110 |
cggggttcgaaccccggaccttgcatatattatgcatt |
9111073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 16204780 - 16204825
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
16204780 |
gtggtggtcgggatttgaaccccggaccttgcatacattatgcatt |
16204825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 28898925 - 28898872
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| || |||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgtccttacca |
28898872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 2213365 - 2213313
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
2213365 |
gtggccgggattctaacttcggaccttgcatatattatgcattgttcttacca |
2213313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 34474297 - 34474253
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34474297 |
tggtggccggggttcgaaccatggaccttgcatatattatgcatt |
34474253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 291422 - 291383
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
291422 |
gaaccccggaccttgcatatattatgcatgatccatacca |
291383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 404234 - 404179
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| | ||| |||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
404234 |
gtggtgtctggggttcgaacctcggacattgcatatattatgcattgtccttacca |
404179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 788937 - 788882
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||| || |||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtccttacca |
788882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 8639101 - 8639062
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
8639101 |
gaaccccggaccttgcatatactatgcattatccatacca |
8639062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 8831262 - 8831223
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8831262 |
gaaccccggaccttgcataaattatgcattgtccttacca |
8831223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 8916464 - 8916519
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||| ||| ||| ||||| |
|
|
| T |
8916464 |
gtggtggccgagatttgaactccggaccttgcatatattatgtattgtccctacca |
8916519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 9977112 - 9977073
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
9977112 |
gaaccccagaccttgcatatattatgcattatccatacca |
9977073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 18254099 - 18254146
Alignment:
| Q |
194 |
cgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
18254099 |
cggggttcgaatcccggaccttgcatgtattatgcattgtccttacca |
18254146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 24248220 - 24248181
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24248220 |
gaaccccggaccttacatatattatgtattatccttacca |
24248181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 31971584 - 31971545
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
31971584 |
gaacctcggaccttgcatatattatgcattgtccttacca |
31971545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 32193849 - 32193904
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||||| ||||| || ||||||||||||||||||||| | ||||||| |
|
|
| T |
32193849 |
gtggtggcggggatttgaacctcgtaccttgcatatattatgcattgttcttacca |
32193904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 247730 - 247680
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
247730 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcct |
247680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 10018470 - 10018420
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
||||||||||| || |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10018470 |
gtggtggccggagtttgaaccccgaaccttacatatattatgcattatcct |
10018420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 235
Target Start/End: Original strand, 14429125 - 14429167
Alignment:
| Q |
193 |
ccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14429125 |
ccgggatttgaaccccggaccttgcatattttatgtattatcc |
14429167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 14750149 - 14750194
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatta |
232 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
14750149 |
gtggtggccgggatttaaaccc-ggaccttgcatatattatgcatta |
14750194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 16390499 - 16390445
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| | || |||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctacca |
16390445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 233
Target Start/End: Original strand, 30639417 - 30639463
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
||||| ||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
30639417 |
tggtgtccgagattcgaacctcagaccttgcatatattatgcattat |
30639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 30960056 - 30960098
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30960056 |
ttcgaaccctggaccttgcatatattaagcattgtccttacca |
30960098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 236
Target Start/End: Complemental strand, 33976311 - 33976265
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatcct |
236 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
33976311 |
tggccggggtttgaaccccggaccttgcatattttatgcattgtcct |
33976265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 219
Target Start/End: Original strand, 1766709 - 1766738
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1766709 |
tggccgggattcgaaccccggaccttgcat |
1766738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 3808108 - 3808161
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||||| ||| || ||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
3808108 |
gtggtggctggggtttgaatctcggaccttgcatatattatgcattgtccttac |
3808161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 12700411 - 12700456
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
12700411 |
gtggtggccggggttcaaaccctagaccttgcatatattatgcatt |
12700456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 13158180 - 13158135
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||| ||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
13158180 |
tggccggggttcgaaccctgtaccttacatatattatgcattatcc |
13158135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 13163036 - 13162991
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatcc |
235 |
Q |
| |
|
|||||||| ||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
13163036 |
tggccggggttcgaaccctgtaccttacatatattatgcattatcc |
13162991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 14049874 - 14049919
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||| ||||| | |||||||||||||||||||||| |
|
|
| T |
14049874 |
gtggtggccggaatttgaacctcagaccttgcatatattatgcatt |
14049919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 15091520 - 15091467
Alignment:
| Q |
188 |
ggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||| |||||| ||||| ||||| |
|
|
| T |
15091520 |
ggtgtccgggattcgaaccccggcccctgcatataatatgcaatatccctacca |
15091467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 15187134 - 15187089
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| |||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
15187134 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcatt |
15187089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 15473472 - 15473517
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||| |||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
15473472 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcatt |
15473517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 17177936 - 17177989
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
|||||||||| |||||||||| | ||||| ||||||||||||||| ||||||| |
|
|
| T |
17177936 |
gtggtggccgagattcgaacctcataccttacatatattatgcattttccttac |
17177989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 239
Target Start/End: Original strand, 22414454 - 22414491
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatccttac |
239 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
22414454 |
gaaccccagacctttcatatattatgcattatccttac |
22414491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 24373700 - 24373745
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
24373700 |
gtggtggctggggtttgaacccctgaccttgcatatattatgcatt |
24373745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 25165348 - 25165303
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
25165348 |
gtggtggctggggttcgaacgccggaccttacatatattatgcatt |
25165303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 28231415 - 28231460
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
28231415 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcatt |
28231460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 1918461 - 1918493
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
1918461 |
ttcgaacctcggaccttgcatatattatgcatt |
1918493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 4455585 - 4455641
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||| || ||||||| ||||||||||||||||||| || ||| ||||| |
|
|
| T |
4455585 |
agtggtggtcggggtttgaaccccagaccttgcatatattatgccttgtccatacca |
4455641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 238
Target Start/End: Complemental strand, 8834985 - 8834949
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
8834985 |
gaaccccggactttgcatacattatgcattatcctta |
8834949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 12808927 - 12808895
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12808927 |
ttcgaaccccagaccttgcatatattatgcatt |
12808895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 13583621 - 13583565
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| |||| || ||||| | || |||||||||||||| |||||||||||||| |
|
|
| T |
13583621 |
agtggtggtcggggtttgaacctctgagcttgcatatattatacattatccttacca |
13583565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 238
Target Start/End: Complemental strand, 18256934 - 18256902
Alignment:
| Q |
206 |
cccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
18256934 |
cccggaccttgcatatattatgcattgtcctta |
18256902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 20744206 - 20744154
Alignment:
| Q |
189 |
gtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||| |||| || ||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcattgtccatacca |
20744154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 21047811 - 21047758
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| ||||| ||| ||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
21047811 |
gtggtgtccggggttcaaaccc--gaccttgcatatactatgcattatccttacca |
21047758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 30358283 - 30358339
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||||| ||||| |||| ||||||||| |
|
|
| T |
30358283 |
agtggtggttgggattcgaactccggactttgcatacattatacattttccttacca |
30358339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 1599 - 1544
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
1599 |
gtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccatacca |
1544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 25460 - 25405
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| | ||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
25460 |
gtggtgtctggggttcgaaccctggaccttgcatatattatgcattgtccttacca |
25405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 18364 - 18309
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||||||| |||| ||||||||| |
|
|
| T |
18364 |
gtggtggccggaattcgaaccctggatcttgcatatattatacattgtccttacca |
18309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 61560 - 61615
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||||||| || |||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
61560 |
gtggtggccggggtttgaaccctggaccttacatacattatgcattatccttacca |
61615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 34891 - 34933
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
34891 |
ttcgaaccctggaccttgcatatattatgcattgtccttacca |
34933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 64288 - 64234
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||| |||| |||||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
64288 |
tggtggtcggggttcgaatcccggaccttgcatatattatgcattgtccatacca |
64234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 17575 - 17530
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17575 |
gtggtgtccgggattcgaaccccaaaccttgcatatattatgcatt |
17530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 102148 - 102103
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
102148 |
gtggtggccgaaattcgaaccccggaccttgcatatattatacatt |
102103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 14807 - 14851
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
14807 |
tggtggccggggttcaaaccccggaccttgcatattttatgcatt |
14851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 7051 - 6995
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcata-tattatgcattatccttacca |
241 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||| ||||||||||| ||| ||||| |
|
|
| T |
7051 |
gtggtggccgggattcgaaccccagaccttacatattattatgcattgtccatacca |
6995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 63609 - 63665
Alignment:
| Q |
185 |
agtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
||||||||| |||||||||||||| ||| || |||||||||||||||||| ||||| |
|
|
| T |
63609 |
agtggtggctgggattcgaaccccagacgttaaatatattatgcattatccatacca |
63665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0524 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0524
Description:
Target: scaffold0524; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 238
Target Start/End: Complemental strand, 1304 - 1253
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
1304 |
tggtggccgggatttgaaccccggaccttatatagattatgcattgtcctta |
1253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 241
Target Start/End: Original strand, 15920 - 15975
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| ||| || ||||||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
15920 |
gtggtggctggggtttgaaccccagaccttgcatatattatacattgtccttacca |
15975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 233
Target Start/End: Complemental strand, 9474 - 9427
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattat |
233 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||| ||||||||||| |
|
|
| T |
9474 |
gtggtggccgggatttgaatcccagaccttgcatattttatgcattat |
9427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 238
Target Start/End: Original strand, 42931 - 42974
Alignment:
| Q |
195 |
gggattcgaaccccggaccttgcatatattatgcattatcctta |
238 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
42931 |
gggattcgaatcccgaaccttgcatatattatgcattattctta |
42974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 190 - 241
Target Start/End: Complemental strand, 239874 - 239823
Alignment:
| Q |
190 |
tggccgggattcgaaccccggaccttgcatatattatgcattatccttacca |
241 |
Q |
| |
|
|||||||| || |||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
239874 |
tggccggggtttgaactccggactttgcatatattatgcattgtccttacca |
239823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 1171 - 1200
Alignment:
| Q |
202 |
gaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1171 |
gaaccccggaccttgcatatattatgcatt |
1200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 31912 - 31957
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
31912 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcatt |
31957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0674 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0674
Description:
Target: scaffold0674; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 6784 - 6740
Alignment:
| Q |
187 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
6784 |
tggtggccggggttcgaaccatggaacttgcatatattatgcatt |
6740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0077 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 8758 - 8718
Alignment:
| Q |
186 |
gtggtggccgggattcgaaccccggaccttgcatatattat |
226 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
8758 |
gtggtggtcgggattcgaacaccagaccttgcatatattat |
8718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Original strand, 91182 - 91214
Alignment:
| Q |
199 |
ttcgaaccccggaccttgcatatattatgcatt |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
91182 |
ttcgaaccccggacattgcatatattatgcatt |
91214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University