View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_low_11 (Length: 501)
Name: NF7987_low_11
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 11 - 262
Target Start/End: Original strand, 43596349 - 43596600
Alignment:
| Q |
11 |
gagtgagatgaatgccagtgaaagcaagtgattcttgattagatttagaaagctgcatcacatcaccgaaagcagtaatatgaacaggacctttaatccc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596349 |
gagtgagatgaatgccagtgaaagcaagtgattcttgattagatttagaaagctgcatcacatcaccgaaagcagtaatatgaacaggacctttaatccc |
43596448 |
T |
 |
| Q |
111 |
gttcgctctaacggcgtcagtgattgacggggctactctggaaacgttaaggccgaccggcacgctgcagttctcgaaatcccaccaaacagaaacccta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43596449 |
gttcgctctaacggcgtcagtgattgacggggctactctggaaacgttaaggccgaccggcacgctgcagttctcgaaatcccaccacacagaaacccta |
43596548 |
T |
 |
| Q |
211 |
acgtttcgtgactcgtcatcgagacgcttccagtgagaatacgacggagccg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596549 |
acgtttcgtgactcgtcatcgagacgcttccagtgagaatacgacggagccg |
43596600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 348 - 459
Target Start/End: Original strand, 43596683 - 43596799
Alignment:
| Q |
348 |
taatagattcttttggagaagatgtctcattgttagttcgttgatcgaatcagaaatggatgcgatgcggtggatt----actccatctgcgt-aaagtg |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
43596683 |
taatagattcttttggagaagatgtctcattgttagttcgttgatcgaatcagaaatggatgcgatgcggtggattactcactccatctgcgtaaaagtg |
43596782 |
T |
 |
| Q |
443 |
gaacagaaatgaaaatg |
459 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43596783 |
gaacagaaatgaaaatg |
43596799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University