View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_low_38 (Length: 281)
Name: NF7987_low_38
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 140 - 263
Target Start/End: Complemental strand, 14108271 - 14108147
Alignment:
| Q |
140 |
aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactata--atatgcttccnnnnnnnnntctccaggacgtcacttgaatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14108271 |
aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactataatatatgcttcc-aaaaaaaatctccaggacgtcacttgaatt |
14108173 |
T |
 |
| Q |
238 |
tctttgttggagtttcctacaaaatg |
263 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14108172 |
tctttgttggagtttcctacaaaatg |
14108147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University