View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_low_41 (Length: 259)
Name: NF7987_low_41
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 77 - 239
Target Start/End: Complemental strand, 9871149 - 9870992
Alignment:
| Q |
77 |
tcacttgtcaaagcttcttagacttgaactcttttttctaaaggaaaattatttttggtatgccgataactcttgtgctgtatcaatttttccctttaaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| || ||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9871149 |
tcacttgtcaaagcttcttagacttgaactcttttctttaatt-----tttttttttctataccgataactcttgtgctgtatcaatttttccctttaaa |
9871055 |
T |
|
| Q |
177 |
ctattgacgatgacatatatatttgaccttggagttattgtttatacttataatgttttttaa |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9871054 |
ctattgacgatgacatataaatttgaccttggaattattgtttatacttataatgttttttaa |
9870992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 128 - 239
Target Start/End: Complemental strand, 9876642 - 9876531
Alignment:
| Q |
128 |
tttttggtatgccgataactcttgtgctgtatcaatttttccctttaaactattgacgatgacatatatatttgaccttggagttattgtttatacttat |
227 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||| |||||||||||||||| || | |||| |||||||||||||||||| |||| ||||| | || |
|
|
| T |
9876642 |
tttttggtatgtcgataactcttgtgatatatcaacgtttccctttaaactatagaaggtgacgtatatatttgaccttggaagtattctttatccaaat |
9876543 |
T |
|
| Q |
228 |
aatgttttttaa |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9876542 |
aatgttttttaa |
9876531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University