View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7987_low_50 (Length: 242)

Name: NF7987_low_50
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7987_low_50
NF7987_low_50
[»] chr7 (1 HSPs)
chr7 (1-212)||(48077141-48077356)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 48077141 - 48077356
Alignment:
1 aatatttcaaagactaaatggagaatgaaactgggtgaaatttggaaaatattggtgtgagaccatatttaattttcccatcgacatacatatcatatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
48077141 aatatttcaaagactaaatggagaatgaaactgggtgaaatttggaaaatattggtgtga--ccatatttaattttcccatcgacatacatatcatatca 48077238  T
101 tgagtataaagtggaaataaataatttactctgtcc------aatccaaatccaaatgaagccaccacttgcagatcacgttgaatggggaaaacagttt 194  Q
    ||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48077239 tgagtataaagtggaaataaataatttactctgtccaatccaaatccaaatccaaatgaagccaccacttgcagatcacgttgaatggggaaaacagttt 48077338  T
195 ccagggaccacacttcat 212  Q
    ||||| ||||||||||||    
48077339 ccaggaaccacacttcat 48077356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University