View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_low_53 (Length: 238)
Name: NF7987_low_53
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_low_53 |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0262 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 12991 - 13213
Alignment:
| Q |
1 |
tctcaatgcatattgaattgggttagaggattgtgacaatgtctaatttgtacggtgattataacacaaagatcgattatgtattcaaggttgtattgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12991 |
tctcaatgcatattgaattgggttagaggattgtgacaatgtctaatttgtacggtgattataacacaaagatcgattatgtattcaaggttgtattgat |
13090 |
T |
 |
| Q |
101 |
tggtgattctgcagttggaaaaactcaattactcggtcgttttgcaaggaacgaatttaaagttgattctaaagccacaattggtgttgaatttcaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13091 |
tggtgattctgcagttggaaaaactcaattactcggtcgttttgcaaggaacgaatttaaagttgattctaaagccacaattggtgttgaatttcaaaca |
13190 |
T |
 |
| Q |
201 |
aaaactttgattattgataataa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13191 |
aaaactttgattattgataataa |
13213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 223
Target Start/End: Original strand, 21336879 - 21337063
Alignment:
| Q |
39 |
atgtctaatttgtacggtgattataacacaaagatcgattatgtattcaaggttgtattgattggtgattctgcagttggaaaaactcaattactcggtc |
138 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||| || ||||| || || ||||||||||||||||| ||||||||||| ||| | || | || |
|
|
| T |
21336879 |
atgtcgaatttatacggtgattataatcagaagatcgattacgttttcaaagtggtgttgattggtgattctgccgttggaaaaacacaacttcttgctc |
21336978 |
T |
 |
| Q |
139 |
gttttgcaaggaacgaatttaaagttgattctaaagccacaattggtgttgaatttcaaacaaaaactttgattattgataataa |
223 |
Q |
| |
|
||||| | ||||| ||||||| |||||||||||||| |||||||||||||| |||||||| |||||| | ||||||||||||| |
|
|
| T |
21336979 |
gtttttcgaggaatcaatttaacgttgattctaaagctacaattggtgttgagtttcaaaccaaaactcttgttattgataataa |
21337063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University