View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7987_low_55 (Length: 227)
Name: NF7987_low_55
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7987_low_55 |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0262 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 12664 - 12893
Alignment:
| Q |
1 |
acaaacatagtgtgtcatgtgtaa-atacttggatatcttaatcatttgattcaaatatctttgattatgtcatatgtaa----aaatacttgtcctagt |
95 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12664 |
acaaacatagtgtgtcatgtgtaacaaacttggatatcttaatcatttgattcaaatatctttgattatgtcatatgtaagtaaaaatacttgtcctagt |
12763 |
T |
 |
| Q |
96 |
ctccacatatatacacattaatgataccttggtttattaaacaaaatacttgataaatgtaataattatttacaattattccgtggaacgcaaggaaaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12764 |
ctccacatatatacacattaatgataccttggtttattaaacaaaatacttgataaatgtaataattatttacaattattccgtggaacgcaaggaaaaa |
12863 |
T |
 |
| Q |
196 |
catttcatttttgttctccactttcatccc |
225 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
12864 |
cgtttcatttttgttctccactttcatccc |
12893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University