View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7987_low_61 (Length: 207)

Name: NF7987_low_61
Description: NF7987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7987_low_61
NF7987_low_61
[»] chr3 (1 HSPs)
chr3 (102-190)||(54828042-54828130)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 102 - 190
Target Start/End: Original strand, 54828042 - 54828130
Alignment:
102 aggagcataatagtgcaaccagtattccaggtgcaggtcaccaccctacggcaactgcaacccatcacccagctgagccaactcatgag 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
54828042 aggagcataatagtgcaaccagtattccaggtgcaggtcaccaccctacggcaactgcaacccatcacccagctgagccaactcttgag 54828130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University